Nanodrop 1000 detector

DNA was extracted from a blood sample using the salting‐out extraction approach (Mardan‐Nik et al., 2019 (link)). The extracted DNA was assessed by the use of a NanoDrop®‐1000‐Detector (NanoDrop‐Technologies, Wilmington, DE, USA). Genotyping was undertaken for rs10789117 in the ANGPTL3 gene using the ARMS PCR (amplification refractory mutation system PCR). Tetra‐ARMS PCRs were undertaken in a 20 μL volume containing 2 μL of DNA samples, 10 μL of PCR Master Mix, 4.5 μL ddH₂O, 0.5 μL for outer primers and 1.0 μL, 1.5 with the following primers (Forward outer primer 5′‐AAAACTCTCATAGGACATGTTTCAT‐3′; Forward inner primer 5′‐CCCTTTTATCTCTCT ACTACTTAATAACAA‐3′; Reverse outer primer 5′‐GAGGGTC AGTGTAGAAAAGATGA‐3′; Reverse inner primer 5′‐CCCTTTTATCTCTCTAC TACTTAATAACAA‐3′; Three band patterns were identified: 194 bp for AA, 291 bp for CC and 432 bp) (Table S1). Genotyping reagents were bought from Applied Biosystems (ABI‐Veriti 96‐well Thermal Cycler). The primers were designed using Primer‐1 and Oligo 7 version 7.24 software. PCR cycling protocols were 94°C for 5 min, 31 cycles at 94°C for 1 min, 56°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 5 min. Gel electrophoresis was attempted using a 2% agarose gel. Finally, the genotypes were confirmed by Sanger sequencing as shown in Figure 1. All sequenced samples were analyzed using Finch TV version 1.4.0.