Trizol total rna extraction kit

We selected 15 tea materials (including 5 large leaf materials, 5 middle leaf materials and 5 leaflet materials) with different leaf sizes and 20 tea materials with different leaf colors (including 5 yellow green materials, 5 light green materials, 5 green samples and 5 dark green materials) for RT-qPCR. For reverse transcription, the total RNA of 35 tea accessions was extracted using the UNIQ-10 column Trizol total RNA Extraction Kit (Sangon Biotech Co. Ltd., Shanghai). RT-qPCR was performed using ChamQ Universal SYBR qPCR master Mix Kit (novozan Biology), using cDNA as a template to detect the expression level of the TEA005350.1 and TEA027527.1 genes in tea varieties with different leaf sizes and colors. The results were analyzed using the 2^ ^{(−△△Ct)} [91 (link)] method, and GADPH (Forward primer: AGCTGCACAACCAACTGTTTG, Reverse primer: AGCTGCACAACCAACTGTTTG) was used as an internal reference gene for relative quantification analysis with three replicates for each sample.

Trizol total RNA extraction kit (Sangon, Shanghai, China) was used to extract total RNA. Next, moloney murine leukemia virus (M-MLV) reverse transcriptase (TakaRa, Dalian, China) was used to perform reverse transcription. Triplicate quantitative assays were performed using SYBR Green Master Mix (TakaRa) with an ABI 7500 sequence detection system. Nine maize PC genes were randomly selected for real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis. The gene-specific primers (Table 3) were synthesized in Sangon. The expression level of Actin 1 (GRMZM2G126010) gene was used as a reference. 2^-ΔΔCT method (Livak and Schmittgen, 2001 (link)) was used to calculate the relative expression level of the PC genes.

Total RNAs were extracted from the brain tissues with Trizol Total RNA Extraction Kit (Sangon, Shanghai, China). Then, RNA was reverse transcribed into cDNA. The mRNA expression levels of TPH2, ERβ, and SERT were detected. β-Actin was used as an internal reference. Primers used in this study were synthesized by Sangon (Shanghai, China) and primer sequences were given in Table 1. The PCR procedures for TPH2 were 94°C for 2 min 30 s followed by 33 cycles of 94°C for 30 s, 59.3°C for 40 s, 72°C for 1 min, and a final extension at 72°C for 7 min. The PCR procedures for ERβ were 94°C for 2 min and 30 s followed by 34 cycles of 94°C for 30 s, 61.6°C for 40 s, 72°C for 1 min, and a final extension at 72°C for 7 min. The PCR procedures for SERT were 94°C for 2 min and 30 s followed by 30 cycles of 94°C for 30 s, 61°C for 40 s, 72°C for 1 min, and a final extension at 72°C for 7 min. The PCR procedures for β-actin were 94°C for 2 min and 30 s followed by 28 cycles of 94°C for 30 s, 59°C for 40 s, 72°C for 1 min, and a final extension at 72°C for 7 min. The amplified products were electrophoresed on 1.2% agarose gel, and the image was analyzed by the gel image analysis system FR-980 (Furi, Shanghai, China). The gray ratio of each gene to β-actin was used as the relative expression of the gene.