The free-hand slices (about 1 mm in thickness) cut from RTBs were put in the water and imaged using a stereomicroscope (SMZ800, Nikon Corporation, Japan). For single staining, the cut slices were immersed in staining solution (1% borax-toluidine blue dissolved in 1% sodium tetraborate as solvent) for 5 s, and rinsed with distilled water to remove residue dye. Then, the stained slices were imaged under light-field conditions using a stereomicroscope (SMZ800, Nikon Corporation, Japan).
Smz800
Manufactured by Nikon
Sourced in Japan, United States, Germany, Netherlands, Canada
The SMZ800 is a stereomicroscope designed for laboratory use. It features binocular observation, a zoom function, and coaxial focusing. The SMZ800 provides users with a clear, high-contrast image for a variety of applications.
Automatically generated - may contain errors
Lab products found in correlation
Eclipse 80i, by Nikon (7 mentions)
Eos 1000d, by Nikon (4 mentions)
Eos 600d, by Canon (4 mentions)
Ds fi1, by Nikon (4 mentions)
Eclipse e600, by Nikon (4 mentions)
Nis elements documentation v 4, by Nikon (3 mentions)
Coolpix 4500, by Nikon (3 mentions)
Bovine serum albumin (bsa), by Merck Group (3 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions)
Ic capture software, by Imaging Source (3 mentions)
Spectramax m5, by Molecular Devices (3 mentions)
Lifecam studio, by Nikon (3 mentions)
Focus 5, by Adobe (2 mentions)
Nis elements ar 4, by Nikon (2 mentions)
Optimal cutting temperature compound, by Sakura Finetek (2 mentions)
Mp e 65 mm macro lens, by Canon (2 mentions)
Triton x 100, by Merck Group (2 mentions)
Tissue culture medium 199, by Thermo Fisher Scientific (2 mentions)
Ds ri2, by Nikon (2 mentions)
Ms 222, by Merck Group (2 mentions)
255 protocols using smz800
1
Free-hand Slice Imaging and Staining
2
Microscopic Imaging and Morphometric Analysis of South Australian Invertebrates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All specimens are stored in ethanol in the South Australian Museum (SAM ). Body measurements were estimated with a Nikon SMZ800 binocular dissecting microscope using an eyepiece scale. Stacks of colour images were manually generated using a Canon EOS 1000D digital SLR camera mounted on the Nikon SMZ800 fitted with a beam splitter, then focus-stacked with Zerene Stacker 1.04 software. One gonopod was cleared in 80% lactic acid, temporarily mounted in a 1:1 glycerol:water mixture and imaged using an eyepiece video camera mounted on an Amscope binocular microscope. Preliminary drawings were traced from printed copies of the images, then corrected by reference to the actual gonopod. Scanning electron microscope images were acquired digitally using a Hitachi SU-70; body parts were examined after air-drying and sputter-coating with platinum, and later returned to alcohol. Figures were composed using GIMP 2.8 software. Parts of the backgrounds of the colour photomicrographs have been edited to remove distracting highlights and artifacts.
Locality details are given with latitude and longitude in decimal degrees based on the WGS84 datum. The estimated uncertainty for a locality is the radius of a circle around the given position in metres. Abbreviations:SA = South Australia, Australia; SAM = South Australian Museum, South Australia, Australia .
Locality details are given with latitude and longitude in decimal degrees based on the WGS84 datum. The estimated uncertainty for a locality is the radius of a circle around the given position in metres. Abbreviations:
3
RPE Cell Migration Assay with Nano-GO
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RPE cell migration was performed using SPLScar Scratchers (24-well lid, SPL Life Sciences, Pocheon, Korea). All procedures were performed according to the manufacturer’s instructions. Straight-line scratches across RPE cells were made using SPLScar Scratchers and then treated with Nano-GO (20 and 40 μg/mL) for 24 h and 48 h, photographed from the straight-line scratch across RPE cells under a stereomicroscope (SMZ800, Nikon Corporation, Tokyo, Japan). Images were captured using an attached IMT i-Solution CAM 3 (IMT iSolution Inc., Vancouver, BC, Canada). The RPE cell migration assay was performed using the CytoSelect 24-Well Cell Migration Assay (Cell Biolabs, San Diego, CA, USA). All procedures were performed according to the manufacturer’s instructions. RPE cells were treated with Nano-GO (20 and 40 mg/mL) for 24 h. Migratory cells were fixed and stained with cell stain solution, and the whole area was photographed (upper chamber) under a stereomicroscope (SMZ800, Nikon Corporation, Tokyo, Japan). Images were captured using an attached IMT i-Solution CAM 3 (IMT iSolution Inc., Vancouver, BC, Canada). Subsequently, the stained cells were extracted with an extraction solution and then measured at 560 nm using an Omega Plate Reader (BMG Labtech, Ortenberg, Germany).
4
Flocculation and Congo-Red Assays for Azospirillum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flocculation tests were performed as previously described [13] (link). Cultures were first grown in NB medium to an A600 of 0.8–0.9 and the cells were harvested by centrifugation at 10,000×g for 1 min. The pellet was washed in minimal medium [13] (link) and then used to inoculate 10 mL of flocculation medium (minimal medium supplemented with 8 mM fructose and 0.5 mM KNO3) in a 50 ml flask, to an A600 of 0.3–0.4. The flasks were incubated with shaking at 200 rpm, 28°C, and checked periodically for flocculation, which took place within 3–4 hours in wild-type Sp7. Flocculation was observed visually and by stereomicroscope (Nikon SMZ800). The NB cultures of Azospirillum strains were also used for a loop spread on solid minimal lactate medium containing 40 µg/mL Congo-Red [6] (link) incubated at 30°C for 3–4 days, and resultant colonies were examined for color and morphology by stereomicroscopy (Nikon SMZ800).
5
Morphological Examination of Larval Specimens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For morphological examination of larvae and exuviae of the last-stage, specimens stored in ethanol were used. The material came from the collection of the Department of Invertebrate Biology, Evolution and Conservation, University of Wrocław (DIBEC ). Larva/exuvium were boiled for 3–10 minutes in 10% solution of KOH, and then rinsed with distilled water. They were then placed in distilled water for ~1 hour to clean and soften the material. All structures were put in glycerin on slides. The morphological structures were studied under a Nikon Eclipse E 600 phase contrast microscope with a drawing tube attached, and a Nikon SMZ-800 binocular microscope; PageBreakexamination was done using transmitted light. Photos were taken with Canon 500D and Nikon Coolpix 4500 cameras under Nikon Eclipse 80i and/or Nikon SMZ-800. In addition to the description provided herein, plates of the larval habitus/pupa as well as drawings of selected elements are also provided.
The terminology used in this paper follows Kiselyova and McHugh (2006) , Kadej and Jaroszewicz (2013) (link), and Kadej et al. (2013a , b ).
The terminology used in this paper follows Kiselyova and McHugh (2006) , Kadej and Jaroszewicz (2013) (link), and Kadej et al. (2013a , b ).
6
Detailed Examination of Alaus melanops Larvae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The specimens of Alaus melanops LeConte, 1863 were obtained from USA (Oregon, leg. A. Smolis). The larvae were preserved in alcohol. Before examination, they were boiled for 3 to 10 min in 10% KOH, rinsed with distilled water, and placed in distilled water for about an hour to clean and soften the cuticle. All structures were placed in glycerin mounts. Larval structures were examined with a Nikon Eclipse E 600 phase contrast microscope with a drawing tube, and a Nikon SMZ-800 binocular microscope. Photographs were taken with a Canon 500D attached to a Nikon Eclipse 80i and a Nikon D5100 camera attached to a Nikon SMZ-800. Image stacks were processed using Combine ZM (Hadley 2010). Plates with figures of selected structures were prepared from larvae. The description and terminology used in this paper follow Casari (2002) . Body length was measured along midline from head apex to apex of last abdominal tergum.
The following abbreviation was used in this study: DIBEC-collection of the Department of Invertebrate Biology, Evolution and Conservation, Institute of Environmental Biology, Faculty of Biological Science, University of Wrocław, Przybyszewskiego 63/77, Wrocław, Poland.
The following abbreviation was used in this study: DIBEC-collection of the Department of Invertebrate Biology, Evolution and Conservation, Institute of Environmental Biology, Faculty of Biological Science, University of Wrocław, Przybyszewskiego 63/77, Wrocław, Poland.
7
Morpholino-based Functional Evaluation of Tmem184a
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All morpholinos (MOs) were purchased from GeneTools, LLC (Philomath, OR) and dissolved in sterile ddH2O. Two non-overlapping MOs targeting Tmem184a were used: one that targeted the translation start site, ATG MO, and one targeting the splice site between pre-mRNA exons 2 and 3, SS MO. A mismatched standard control (Con MO) was also used to control for off target effects. The ATG MO was tagged with lissamine rhodamine, and the SS MO and Con MO were tagged with fluorescein. Sequences of MOs were as follows: ATG MO 5′CTGAGAGTAGTTTCATTCATCCTGA3′; SS MO 5′AAACAGGCACACTCACTGAATGGGC3′; Con MO 5′CCTCTTACCTCAGTTACAATTTATA3′. Microinjection and electroporation procedures were performed as described previously using a Norishinge IM 300 microinjector and visualized under Nikon SMZ 800 with a 1x objective (Banerji et al., 2016 (link)). MO-injected fins were evaluated for vascular regeneration phenotype, total and vascular regeneration length, cell proliferation, and protein expression by western blot and immunostaining.
8
Ovarian Maturity and Longevity of Parasitoids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To estimate the number of mature eggs in the ovary at emergence, 1-h-old females (N = 15 for the three developmental temperatures) were dissected in a drop of isotonic saline solution under a binocular (×6.3; Nikon SMZ 800). Mature eggs were distinguished from non-mature eggs, according to Le Ralec [57 (link)]. For each female, we measured the length of the hind tibia in the same way as described above.
To assess the longevity of parasitoids, adults (30 males and 30 females per treatment) were isolated individually without host or food in centrifugation tubes (1.5 mL, Eppendorf, Hamburg, Germany). Survival was monitored every day at 20 °C, under a 16L:8D photoperiod regime at 50% relative humidity level until death to determine lifespan.
To assess the longevity of parasitoids, adults (30 males and 30 females per treatment) were isolated individually without host or food in centrifugation tubes (1.5 mL, Eppendorf, Hamburg, Germany). Survival was monitored every day at 20 °C, under a 16L:8D photoperiod regime at 50% relative humidity level until death to determine lifespan.
9
Evaluating Lens Transparency in Mice
10
ROX SE Perfusion Technique in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 10 mM stock solution of 5 - (and - 6)-Carboxy-X-rhodamine, succinimidyl ester (AS-81110, AnaSpec, Freemont, CA, USA) in DMSO was diluted into 10 mM glucose – Phosphate Buffered Saline (PBS) for a final working solution of 20 μM ROX SE in 10 mM glucose-PBS. Mice were anesthetized with isoflurane and transcardially perfused at a constant pressure of 80 ± 5 mm Hg with 10 mL of 10 mM glucose PBS – Heparin (1000 USP units/ml), followed by 20 mL of 10 mM glucose PBS, 20 mL of the 20 μM ROX SE working solution, and 20 mL of 4% paraformaldehyde (Fig. 1 ). Brains were extracted under a dissecting microscope (Nikon SMZ 800) and stored in 4% paraformaldehyde at 4 °C for 48 hours and then transferred into 30% sucrose solution.![]()
Schematic of ROX SE perfusion in mice. In the ROX SE perfusion technique, the following solutions are perfused in sequence: 1) 10 mL of 10 mM glucose-PBS-Heparin, 2) 20 mL of 10 mM glucose-PBS, 3) 20 mL of 20 μM ROX SE solution, and 4) 20 mL of 4% paraformaldehyde. Perfusion pressures are maintained at 80 ± 5 mm Hg as indicated by the attached sphygmomanometer.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!