Dneasy mini kit

A subsample of 20 g oat grains per field was ground with an oat grinder (Retsch ZM 200, Scientific Inc. Newtown, PA, USA). One-gram grain flour was used to extract DNA using the QIAGEN DNeasy Mini Kit (QIAGEN Mississauga, ON, Canada) following the manufactures’ procedure.
Quantitative PCR was used to determine the abundance of Fusarium genomic DNA in oat using a CFX96™ Real-Time PCR Detector System (BioRad, Mississauga, ON, Canada). All standards and the negative control (double-distilled water) were run in triplicate. Primers, based on the elongation factor 1α (Tef-1α) gene for three Fusarium species (F. graminearum, F. poae, and F. sporotrichioides), were used to quantify Fusarium genomic DNA in oat grains (Table S1). The PCR was carried out in a total volume of 20 μL, consisting of 10 μL of SsoFast EvaGreen^® PCR Master Mix (BioRad), 1 μL of each primer, 6 μL of double-distilled water, and 2 μL of template DNA with a 37-cycle threshold (Ct) detection limit. PCR conditions were as follows: initial preheating at 98 °C for 2 min; 40 cycles of 95 °C for 15 s and 62 °C for 1 min; and dissociation curve analysis at 60 to 95 °C. Six technical replicates were performed for each sample.

iSLK.219 cells were maintained as described above and were transfected using Lipofectamine RNAiMAX (Life Technologies) according to the manufacturer’s instructions. At 48 hours post-transfection, the medium was changed to DMEM containing 1% Pen-Strep, 10% FBS, and 0.2 μg/ml of doxycycline for reactivation [20 (link)]. BCBL-1 siRNA transfections were performed using Lonza nucleofector V kit according to the manufacturer’s recommendations (Lonza). BCBL-1 PEL cells were reactivated with 1 mM sodium butyrate (Sigma) and 25 ng/ml 12-O-tetradecanoyl-phorbol 13-acetate (TPA) (Sigma) where indicated. At 0, 24, 48 or 72 hours post-reactivation, cells and supernatant were collected. RNA was harvested from cells via the RNeasy Plus mini kit (Qiagen) for analysis of levels of viral transcripts. DNA was harvested from both cells and supernatant via DNeasy mini kit (Qiagen) for analysis of genome copy numbers. Protein from cells was harvested for WB analysis.

Genomic DNA was extracted from mouse dLGN tissues using DNeasy mini Kit (Qiagen) according to the manufacturer’s instructions. One microgram genomic DNA per sample was spiked with 0.02% unmethylated cl857 Sam7 Lambda DNA (Promega) for library construction and sonicated to 200-bp fragments with Covaris M2 (AB). After end repair, dA tailing, the DNA fragments were ligated with cytosine-methylated Illumina TruSeq DNA adapters using T4 DNA ligase (NEB) overnight. After purification, adapter-ligated DNA fragments were subject to bisulfite conversion using the EpiTect Bisulfite Kit (Qiagen). After bisulfite conversion, the single-stranded uracil-containing DNA was subjected to 12 cycles of PCR amplification with Illumina TruSeq PCR primers and 2.5 U Pfu TurboCx Hotstart DNA polymerase (Agilent) to recover enough DNA for sequencing. The recovered libraries were sequenced on Hiseq 4000 platform (Illumina).

For the quantification of relative fungal biomass, plant and fungal genomic DNA (gDNA) was isolated from infected leaves collected at 14 dpi using DNeasy mini kit (Qiagen, Germany) for experiment 1 and at 13 dpi using an adapted CTAB protocol (Doyle and Doyle, 1987 ) for experiment 2. Relative fungal biomass was quantified by real-time PCR using 20 ng of gDNA as a template for amplification. PCR was performed using primer pair Fw-On-CGCCAAAGACCTAACCAAAA and Rv-On-AGCCAAGAGATCCGTTGTTG, designed on internal transcribed spacer sequence 1 sequence specific to O. neolycopersici (GenBank accession number EU047564) (Huibers et al., 2013 (link)) and Fw-EF-GGAACTTGAGAAGGAGCCTAAG and Rv-EFCAACACCAACAGCAACAGTCT for tomato reference gene Elongation Factor 1α (Ef1α). Relative fungal biomass was calculated using the 2^–ΔCt method (Livak and Schmittgen, 2001 (link)) with tomato EF1α as the reference gene.

A homologous recombination assay was performed according to the manufacturer’s instructions (Norgen Biotek Corp., cat#35600). Briefly, LN229 cells expressing either shCTRL or shCHD4#1 were co-transfected with dl-1 and dl-2 plasmids (or negative and positive control plasmids), and total genomic DNA was isolated 48 hours later using the DNeasy mini kit (Qiagen, cat#69504). A qPCR reaction was performed using the supplied primers to determine HR efficiency. If HR is perturbed, the dl-1 and dl-2 plasmids will not recombine to produce a PCR product; therefore, the amount of PCR product is directly correlated with HR efficiency.