Easyscript first strand cdna synthesis supermix

Total RNA was extracted from retina and choroid of eyes in eight groups using TRIzol reagent (Invitrogen) following the manufacturer’s instructions. 2 μg total RNA from each sample was reverse-transcribed to cDNA with Easy-Script First-Strand cDNA Synthesis SuperMix (TransGen Biotech). The gene-specific primers (SBS Genetech) were listed in Table 3. RT-PCR was performed using SYBR Green RT-PCR Master Mix (TransGen Biotech) according to the manufacturer’s instruction. The GAPDH was set as the internal control gene in the animal and cellular experiments. The relative quantity of mRNA expression was calculated according to the formula: 2^{-(targetgeneCt – GAPDHCt)} * 10³, in which Ct was the threshold cycle number. All assays were repeated at least in triplicate independently. The RNA from different animals was measured individually.Table 3

Primer sequences for PCR analysis.

Target	Primer sequence (5’- 3’)	Length (bp)
P2X4	Forward TGTCCCCAGGCTACAATTTC Reverse GGCAGCTTTTTCTCCCTTCT	373
P2X7	Forward CTTTTGCACCTTGAGCTTCC Reverse TCCATGCTAAGGGATTCTGG	152
P2Y2	Forward GTGGCCTACAGCTTGGTCAT Reverse GCGTGCGGAAGGAGTAGTAG	235
P2Y12	Forward AGTGATGCCAAACTGGGAAC Reverse TGAATGCCCAGATAACCACA	208

The qRT-PCR was performed as described previously (15 (link)). Briefly, total RNA was extracted using TransZol Up Plus RNA Kit (Transgen, Beijing, China) following the manufacturer's instructions. 0.5 μg total RNA was reverse transcribed using the EasyScript® First-Strand cDNA Synthesis SuperMix (Transgen, Beijing, China). The mRNA expression levels were measured by TransStart® Tip Green qPCR SuperMix (Transgen, Beijing, China) on a Roche 480 real-time PCR system thermocycler. Each sample was analyzed in triplicates and target gene expression was analyzed by 2^−ΔΔCt method (16 (link)), following normalization with β-actin gene. The primers used are provided in Table 1.

Total RNA was extracted from the WT and different transformants grown in the fermentation medium. EasyScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China) was used for reverse transcription to obtain cDNA. RT-qPCR was performed using Go Taq qPCR Master Mix (Promega, Madison, Wisconsin, USA) in a real-time PCR system (Thermo Fisher Scientific, Wilmington, Massachusetts, USA), with the β-actin gene as the internal control gene. The relative expression levels of Cmr1, PKS, SCD1, and THR1 were quantitatively detected, and expression levels were evaluated using the 2^−ΔΔCT method.

Total RNA of MC3T3-E1 cells was extracted on day 14 using the Trizol method (Sigma-Aldrich, MO, USA), and cDNAs were synthesized using EasyScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). The RT-PCR system included 2.5 μL in cDNA, 1 μL of primer pair, and TransStart™ SYBR Green qPCR Supermix (TransGen Biotech, Beijing, China). The PCR cycle was set as 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec, and 72°C for 30 sec, with a final step at 72°C for 10 min. The miR-155 primers and the internal reference U6 were purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, China). The primers for SMAD5, ALP, and GAPDH were synthesized by Sangon Biotech, Shanghai, China. The primer sequences were as follows: SMAD5-F, CCAGCCGTGAAGCGATTG and SMAD5-F, GCCTTTTCTGCCCATTTCTCT; ALP-F, 5′-GAGCAGGAACAGAAGTTTGC-3′ and ALP-R, 5′-GTTGCAGGGTCTGGAGAGTA-3′; GAPDH-F, 5′-AACTCCCATTCCTCCACCTT-3′ and GAPDH-R, 5′-GAGGGCCTCTCTCTTGCTCT-3′. The expressions were calculated by 2^−ΔΔCT method using GAPDH expression level as internal control.

Total RNA of primary NSs was extracted using an RNA extraction kit (QIAGEN, Hilden, Germany). cDNA samples were synthesized using an EasyScript First-Strand cDNA Synthesis SuperMix (Transgen Biotech, Beijing, China). The gene-specific primers (Supplementary Table S2) were designed by PrimerBank (Wang et al. 2012 (link)). A TransStart Green qPCR SuperMix UDG kit (TransGen Biotech) was applied to prepare the qPCR samples, which were run in triplicate on a Rotorgen Q real-time PCR cycler (QIAGEN). Thermal cycling was performed at an initial UDG incubation step at 50°C and a UDG inactivation step at 94°C, and then subjected to 45 cycles of 15 s denaturing at 95°C, 30 s at annealing temperature, and a 30 s extension at 72°C. Quantitative gene expressions were referenced to Tubb5 and normalized to the GMF samples.

Total RNA extraction was performed by Mouhu et al. [36 (link)]. The cDNA for qRT-PCR was synthesized using an EasyScript® First-Strand cDNA Synthesis SuperMix (TransGen, China). We amplified PCR products in triplicate using PerfectStart® Green qPCR SuperMix (TransGen, China) in 10 µL reactions for qRT-PCR analysis. PCR was performed using the Bio-Rad CFX96 Touch real-time PCR Detection System (Bio-Rad, USA), and cycling conditions consisted of denaturation at 95℃ for 30 s, followed by 40 cycles at 95℃ for 5 s, annealing at 60℃ for 30 s, and extension at 72℃ for 30 s. We used FvH4_4g24420 encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control. Specific primers for the FvePLs were listed in Additional file 1. The relative expression data were calculated using the 2^−ΔΔCt method [37 (link)].

The mRNA expression levels of Nrf2 in MTECs and HK2 were detected by qPCR. Total RNA was extracted from the cells using the TransGen Biotech (Beijing, China) reagent according to the manufacturer’s instructions. EasyScript First-Strand cDNA Synthesis SuperMix was used to obtain the cDNA templates (TransGen Biotech, Beijing, China), and mRNA transcription was determined using SYBR Green qPCR kits and analyzed using real-time PCR systems. Each analysis was repeated three times.