Real-time PCR amplification and analysis were performed using StepOneTM with software version 3.1 (Applied Biosystems, USA). The reaction contained SYBR Green Master Mix (Applied Biosystems). Gene-specific primer pairs (Table 1 ) were designed using Gene Runner (Hasting Software, Inc., USA) by utilizing RNA sequences from the GenBankⓇ is the NIH genetic sequence database gene bank. All primer sets had a calculated annealing temperature of 60°C. Real-time quantitative PCR was performed in a 25-μl reaction volume consisting of 2 × SYBR Green PCR Master Mix (Applied Biosystems), 900 nM of each primer, and 2 μl of cDNA. The amplification conditions were as follows: 2 min at 50°C, 10 min at 95°C, and 40 cycles of denaturation for 15 s and annealing/extension at 60°C for 10 min. Data from the real-time assays were analyzed using StepOneTM with software version 3.1 (Applied Biosystems, USA). Relative gene expression of the studied gene mRNAs was calculated using the comparative Cycle threshold value (Ct method). All values were normalized to those of glyceraldehyde 3-phosphate dehydrogenase, which was used as the control housekeeping gene, and reported as fold change over background levels detected in the diseased groups.
Stepone
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan, China, United Kingdom, France, Germany, Italy, Singapore
The StepOne is a real-time PCR system designed for reliable and accurate quantification of nucleic acid targets. It features a compact and user-friendly design, supporting a range of sample types and applications. The StepOne system provides researchers with the essential tools for gene expression analysis, genotyping, and other real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (57 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (38 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (21 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (18 mentions)
Trizol, by Thermo Fisher Scientific (11 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (10 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (10 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (10 mentions)
Taqman probe, by Thermo Fisher Scientific (10 mentions)
Rneasy mini kit, by Qiagen (9 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (8 mentions)
Sybr green, by Thermo Fisher Scientific (7 mentions)
Nanodrop, by Thermo Fisher Scientific (7 mentions)
Sybr green master mix, by Thermo Fisher Scientific (7 mentions)
Nucleospin rna, by Takara Bio (7 mentions)
Primescript rt master mix kit, by Takara Bio (7 mentions)
Dnase 1, by Thermo Fisher Scientific (6 mentions)
Rneasy micro kit, by Qiagen (6 mentions)
Steponeplus, by Thermo Fisher Scientific (6 mentions)
Superscript 3, by Thermo Fisher Scientific (6 mentions)
326 protocols using stepone
1
Real-time PCR Analysis of Gene Expression
2
Transcriptional Profiling of Uterine Sox Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from the naturally mated C57BL/6 female mice at 18:00–20:00 on DOP 4 using TRIzol® in combination with a PureLink® RNA mini kit and on-column DNase digestion (Thermo Fisher). Reverse transcription was performed using a SuperScript® III first-strand synthesis system for RT-PCR (Thermo Fisher) with random hexamers. Real-time PCR was performed by StepOne™ with TaqMan® Fast Advanced Master Mix (Thermo Fisher). The TaqMan® gene expression assays used in this study included Sox17 (Mm00488363_m1), Sox7 (Mm00776876_m1), Sox18 (Mm00656049_gH), Actb (Mm02619580_g1), and Gapdh (Mm99999915_g1). Data were analysed by the comparative CT (ΔΔCT) method, in which Actb or Gapdh served as an internal control, and uterus data were used as a calibrator38 (link). We confirmed that the target genes and the internal control genes had similar PCR efficiencies, which were close to 100% (Supplementary Fig. S2 ).
3
miRNA Extraction and Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MicroRNAs were extracted and purified using the miRNeasy Mini kit (Qiagen, Hilden, Germany). miRNA expression levels were measured via quantitative reverse transcription- (qRT-) PCR using StepOne (Thermo, Waltham, USA). The cycling conditions were as follows: 95°C for 10 min, followed by 40 cycles of amplification at 95°C for 15 s, and 60°C for 60 s. The relative miR-3059-3p expression level was calculated using the 2−ΔΔCt method. U6 was used as an internal control.
4
Quantitative RT-qPCR for RVFV Viral RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All viral RNAs and synthesized RNAs were used as templates for RT-qPCR using the StepOne and StepOne Plus Real-Time PCR system (ThermoFisher, USA). The RT-qPCR mixtures had a final volume of 20 µL consisting of 10 µL of 2× one-step RT-PCR buffer III (TaKaRa Bio, Japan), 0.4 µL of TaKaRa Ex Taq HS (5 U/µL), 0.4 µL of primescript RT enzyme mix II (TaKaRa Bio, Japan), 0.4 µL of 50× ROX reference dye, 1 µL of 10 µM forward primer, 1 µL of 10 µM reverse primer, 1 µL of a 5 µM probe with 5′-FAM-labeled, 5 µL of RNA template and 0.8 µL of nuclease-free water with one-step PrimeScript™ RT-PCR Kit (TaKaRa Bio, Japan). The RT-qPCR was carried out under the following conditions: reverse transcription at 42 °C for 5 min and enzyme activation at 95 °C for 10 min followed by 40 cycles of denaturation at 95 °C for 10 s and annealing and extension at 60 °C for 35 s (Fig. 3 A). In addition, six templates were used for the standard curves except for templates at a number at the attogram level.![]()
Two PCR-based methods for quantification of the rift valley fever virus (RVFV). (
5
RT-qPCR Analysis of Plant Stress Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pooled total RNA (1.0 μg) from 5 plants, from two independent experiments, was retro-transcribed into cDNA according to the manufacturer's indications using the SCRIPT cDNA Synthesis Kit (Jena Bioscience www.jenabioscience.com ). RT-qPCR was performed in 96-well plates with the Applied Biosystems StepOne™ and StepOnePlus™ Real-Time PCR System (ThermoFisher Scientific), using SYBR Green Maxima SYBR Green/ROX qPCR Master Mix (2X) (ThermoFisher Scientific, www.thermofisher.com ). Two independent experiments were analyzed with three technical replicates each. RT-qPCR conditions were as follows: an initial 95°C denaturation step for 15 min followed by denaturation for 15 s at 95°C, annealing for 30 s at 60°C, and extension for 30 s at 72°C for 45 cycles. Gene expression values were normalized using the mean expression of two genes: AT4G26410 and AT1G72150 previously described as stable reference genes (Serrano and Guzmán, 2004 (link); Czechowski et al., 2005 (link)). Normalized gene expression was determined using the comparative 2−ΔΔCT method previously described (Schmittgen and Livak, 2008 (link)). Primers for ACS6, PR4, and PDF1.2 gene expression were previously described (Hael-Conrad et al., 2015 (link)).
6
Quantifying Inflammatory Gene Expression in Colon Polyps
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the polyps of similar size from the distal colon of each mouse using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and qPCR was performed using cDNA generated from 1 µg of total RNA with a cDNA synthesis kit (Quantabio, Beverly, MA, USA). qPCR reactions were carried out on 20 ng cDNA per reaction using n SYBR Green PCR master mix (Quantabio, Beverly, MA, USA) using a step-one (Thermo Fisher, Waltham, MA, USA) analysis system. Relative expression values were quantitated using the comparative cycle threshold method and normalized to mouse β-actin. The following primers were used:
Primer Sequence 5′-3′ β-actin_F GTCACCCACACTGTGCCCATC β-actin_R CCGTCAGGCAGCTCATAGCTC IL-6_F CCGGAGAGGAGACTTCACAG IL-6_R GGAAATTGGGGTAGGAAGGA Arg1_F TTGGGTGGATGCTCACACTG Arg1_R TTGCCCATGCAGATTCCC IL-17_F ACCGCAATGAAGACCCTGAT IL-17_R TCCCTCCGCATTGACACA CD8_F CCGTTGACCCGCTTTCTGT CD8_R CGGCGTCCATTTTCTTTGGAA
7
Thermal Stability Analysis of Ami1 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Differential scanning fluorimetry (DSF) was performed to determine the thermal stability of the Ami1 on a real-time PCR device (Applied Biosystems® StepOne™, Thermo Fisher Scientific) (Meekins et al. 2015 (link); Murphy et al. 2022 ). Briefly, the DSF reaction assays (20 μL) were prepared by mixing appropriate amount of purified enzyme (10 μg) in a buffer system (HEPES/NaOH 0.02 M, pH 7) containing 15 × SYPRO™ Orange (Invitrogen, USA). Fluorescence intensity was monitored following a temperature gradient that covered a range between 10 and 98 °C at a constant scan rate of 1 °C/90 s. All measurements were performed in quadruplicates. The obtained data were successfully used to fit the Boltzmann sigmoidal function curve. The melting temperature (Tm) was calculated using the computer program GraphPad Prism version 9.3.1 (GraphPad Prism Software, Inc.).
8
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized using 1 μg of RNA and the Improm Kit (Promega). Real-time quantitative PCR (qPCR) assays of first-strand cDNA were performed with Step One (Thermo Fisher Scientific) and Sybr Green (Promega). The expression ratios were computed via the ΔΔCt method. The primers used are listed in Supplementary Table 1
9
Quantitative analysis of obst-E isoforms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type and KO/Del, Act>b mutant feeding larvae were collected at 91–94 hours after egg laying. Pools of larvae, each consisting of 8–12 larvae, were immediately homogenized in 500μl each of TRI reagent (Sigma-Aldrich), incubated for 5 minutes at room temperature, and stored at -70°C for 2–4 weeks. Total RNA was extracted according to the manufacture’s protocol. After DNaseI treatment (Takara) and phenol-chloroform extraction, reverse transcription was performed using Verso cDNA synthesis kit (Thermo Fisher Scientific) with random hexamer primers and 1μg of total RNA per pool as template. qPCR was conducted on StepOne (Thermo Fisher Scientific) using Power SYBR Green Master Mix (Thermo Fisher Scientific). The following primers were used. obst-E Fw (common), 5’-CGTTGCCATGTTTGGCTC-3’; obst-E-a Rv, 5’-AATGTAGGCATCGCAGGA-3’; obst-E-b Rv, 5’-GTGTAAGAGTCGCACTGG-3’; RpL32 (Ribosomal protein L32) Fw, 5’-TACAGGCCCAAGATCGTGAAG-3’ and RpL32 Rv, 5’-GACGCACTCTGTTGTCGATACC-3’. The specificity of all primers was verified by melt curve analysis. Standard curves were generated for all primer pairs, and relative expression levels of obst-E variants a and b were normalized using RpL32 as an internal control.
10
Quantification of RNA Levels in Cancer Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!