Yeast two-hybrid assay was performed by using Yeast Transformation System 2 (Clontech) according to the manufacturer’s instructions.
Yeast transformation system 2
Manufactured by Takara Bio
Sourced in United States
The Yeast Transformation System 2 is a laboratory equipment designed for the efficient transformation of DNA into yeast cells. It provides a standardized protocol and components to facilitate the introduction of genetic material into Saccharomyces cerevisiae and other yeast species.
Automatically generated - may contain errors
Lab products found in correlation
10 protocols using yeast transformation system 2
1
Yeast Two-Hybrid Protein Interaction Assay
2
Yeast Transformation for Protein-Protein Interaction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Yeast cells, strain Y2HGold (Clontech), were transformed with the plasmid pGBD-GTW using the Yeast Transformation System 2 (Clontech) following manufacturer's instructions and plating them on a Synthetically Defined medium without Tryptophan (SD-Trp). Plasmid pGBD-GTW contains a gene which confers the ability to grow on media without Tryptophan. Transformed yeast cells were resuspended in NaCl 0.9% solution until OD600 of 2 and then plated in different selective media. After 3 days incubation at 30°C, growing of yeast cells was visible.
3
Yeast Two-Hybrid Screening for NS5A Interactors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A Matchmaker two-hybrid system (catalog no. 630489; Clontech) was used to screen host proteins that interact with NS5A. Briefly, the bait construct pGBKT7-NS5A (BD-NS5A) was transformed into the yeast strain Y2HGold and hybridized with a cDNA library derived from porcine macrophages [39 (link)]. Transformants were selected for growth on synthetically defined (SD) medium lacking His, Leu, Trp and Ade (SD/-4) for 3 to 6 days at 30 °C. The clones were then transferred to SD/-4 medium containing 5-bromo-4-chloro-3-indolyl-α-D-galactopyranoside (X-α-Gal) and aureobasidin A (Aba) (SD/-4/X-α-Gal/Aba). Blue colonies were selected and inoculated with 5 mL of SD/-4 medium for shaking culture at 30 °C for 1 to 3 days. Yeast plasmids were extracted using a yeast plasmid kit (catalog no. D3376; Omega, Guangzhou, China) according to the manufacturer’s instructions, and the target inserts were verified by sequencing using the Gal4 AD and 3ʹAD primers. To validate the interaction between NS5A and the cellular proteins, the bait and prey plasmids were cotransformed into the Y2HGold yeast strain using a yeast transformation system 2 (catalog no. 630439; Clontech). The interaction between murine p53 and SV40 large T-antigen was used as a positive control, and the human lamin C protein, which does not interact with the SV40 large T-antigen, was included as a negative control.
4
Yeast Two-Hybrid Screening of OsMADS16
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct bait vector for the Y2H analysis, the full-length CDS of OsMADS16 was amplified with primers containing the restriction sites of EcoR I and BamH I (F: CGGAATTCATGGGGAGGGGCAAGATC, R: CGCGGATCCTCAACCGAGGCG CAGGT), and then cloned into bait vector pGBKT7 harboring GAL4 DNA-binding domain (BD). The correct recombination vector was introduced into yeast competent cell AH109 using PEG/LiAc-mediated method following the Yeastmaker Yeast Transformation System 2 protocol (Clontech, Cat. No.630439), and culture was spread on SD/-Trp plate. To test the self-activation of OsMADS16, yeast competent cell AH109 was cotransformed with bait vector pGBKT7-OSMADS16 and empty vector pGADT7 and selected on SD/Leu/-Trp/-His plate. The vectors pGBKT7-p53 and pGADT7-T were used as positive control, while pGBKT7-Lam and pGADT7-T were used as negative control.
5
Yeast Co-Transformation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The bait plasmid pDHB1-EtMIC3 and the library empty plasmid pPR3-N were co-transformed into the positive pOst-Nub I and NMY51 yeast, respectively, and cultured in SD-leu-trp and SD-leu-trp-his-ade selective culture medium using the Yeastmaker Yeast Transformation System 2 (Clontech, USA). The number of colonies in different plates was counted to calculate its growth rate.
6
Yeast Two-Hybrid Protein Interaction Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The yeast Gal4 system was employed for two‐hybrid analysis following yeast transformation handbook (Yeast Transformation System 2, Clontech, CA, USA). The protein interaction assay was performed as previous described (Wu et al., 2020 (link)).
7
Yeast Two-Hybrid Analysis of MdBT2 Interactors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To screen the proteins that interact with MdBT2, the full-length cDNA of MdBT2 was fused to the binding domain of the pGBT9 vector as bait (BD-MdBT2). The apple cDNA library was generated from apple skin and constructed by Oebiotech Company. Y2H screening was conducted according to the Yeast Transformation System 2 manufacturer’s instructions (Clontech, Shanghai, China), and the positive clones were determined by sequencing.
For the Y2H assays, the coding sequences of AtBTs and MdBTs and the truncated sequences of MdBT2 were cloned into a pGBT9 bait vector, while the full-length CDSs of MdGRFs and AtGRFs were inserted into a pGAD424 prey vector. The recombinant constructs were then cotransformed into yeast strain Y2H Gold as described in the manufacturer’s instructions (Clontech). The transformed yeast cells were cultured on SD/-Trp-Leu (-T/-L) and SD/-Trp-Leu-His-Ade (-T/-L/-H/-A) media supplemented with 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (X-α-gal) for selection.
For the Y2H assays, the coding sequences of AtBTs and MdBTs and the truncated sequences of MdBT2 were cloned into a pGBT9 bait vector, while the full-length CDSs of MdGRFs and AtGRFs were inserted into a pGAD424 prey vector. The recombinant constructs were then cotransformed into yeast strain Y2H Gold as described in the manufacturer’s instructions (Clontech). The transformed yeast cells were cultured on SD/-Trp-Leu (-T/-L) and SD/-Trp-Leu-His-Ade (-T/-L/-H/-A) media supplemented with 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (X-α-gal) for selection.
8
Yeast Two-Hybrid Assay for LBD37/38/39 and BES1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length cDNAs of LBD37/LBD38/LBD39 or BES1 were subcloned and fused into pGADT7 or pGBKT7 (Clontech) as prey or bait vectors. Both the bait and prey constructs were co-transformed into yeast AH109 cells according to the Yeast Transformation System 2 user manual (Clontech). The yeast clones were cultured on selective medium (SD/-Leu/-Trp/-His/-Ade, -LWHA) at 30°C for 3 days.
9
Yeast Two-Hybrid Screening of Meiosis Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from wild-type anthers during meiosis. Highly purified and intact mRNA was isolated using mRNA Purification Kit (Life technology, NO. 61006). cDNA library construction was performed using Make Your Own Mate & Plate Library System (Clontech NO.630490) according to the manufacturer’s instructions. The Y2H assay was conducted with Yeast Transformation System 2 (Clontech NO.630439). The yeast strain Y2HGOLD was used for library screening and Y2H assays. All primers used were listed in S2 Table .
10
Yeast Transformation for Protein Interaction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purified double-stranded cDNA (5 μg) and SmaI-linearized pGADT7-Recexpression vector (3 μg) were mixed to co-transform bait yeast using the Yeast maker Yeast Transformation System 2 (Clontech). Yeast cell suspensions were diluted to 1/10, 1/100, 1/1000, and 1/10000, and 100-μL diluents were coated onto SD-Leu plates to screen the total number of colonies. The remaining yeast cell suspensions (approximately 15 mL) were coated on corresponding SD-Leu/AbA plates (200 μL per plate) to preliminarily screen the positive colonies. The number of colonies on SD-Leu was calculated 3–5 days later using the following formula: total number of colonies = colony-forming unit/volume of coated plate × dilution rate × total volume of cell suspension.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!