Human il 15

Manufactured by Thermo Fisher Scientific

Sourced in Germany, United States

Human IL-15 is a recombinant protein that represents the mature form of the human interleukin-15 cytokine. It is a member of the 4-alpha-helix bundle cytokine family and plays a role in the activation and proliferation of T cells and natural killer cells.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

IL-15 (444 citations) Recombinant human IL-15 (51 citations) Recombinant human IL-7 and IL-15 (4 citations) Recombinant human IL-2 or mouse IL-15 (2 citations)

18 protocols using human il 15

Isolation and Cytokine Stimulation of Human NK Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human PBMCs from anonymous healthy donors were obtained from leukoreduction filters after platelet apheresis from the UCLA Virology Core. NK cells were isolated using the EasySep Human NK Cell Isolation Kit (Stem Cell Technologies) following the manufacturer's instructions. Following isolation, cells were maintained in 24-well G-Rex plates (Wilson Wolf) in NK MACS medium (Miltenyi Biotech) supplemented with human IL-2 (100 IU ml -1 , PeproTech) and human IL-15 (20 ng ml -1 , PeproTech) at a plating density of 5 × 10 6 cells per well. For cytokine stimulation, either freshly isolated human NK cells or cells activated for 14 d with IL-2/IL-15 were plated with K562 leukemia cells at an effector:target ratio of 2.5:1 in addition to human IL-2 (100 IU ml -1 , PeproTech), human IL-15 (20 ng ml -1 , PeproTech), human IL-12 (10 ng ml -1 , PeproTech) and/or human IL-18 (100 ng ml -1 , PeproTech) in CR-10 media. NK cells were stimulated with cytokines for 16 h before analysis by flow cytometry.

Cheng M.I., Li J.H., Riggan L., Chen B., Tafti R.Y., Chin S., Ma F., Pellegrini M., Hrncir H., Arnold A.P., O'Sullivan T.E, & Su M.A. (2023). The X-linked epigenetic regulator UTX controls NK cell-intrinsic sex differences. Nature immunology, 24(5).

+ Open protocol

+ Expand

Feeder-Based ILC1 Culture and Proliferation

Check if the same lab product or an alternative is used in the 5 most similar protocols

OP9, OP9-DL1 and OP9-DL4 feeder cells were grown at 5% CO2 in 1x MEM alpha (Gibco) supplemented with 20% FCS and 1x penicillin-streptomycin. At 80-90% confluence cells were treated with 10 μg/ml mitomycin C (Sigma Aldrich) for 1.5h. Cells were washed three times with PBS and detached with trypsin–EDTA (Gibco) at 37 °C for 5 min. 40.000 cells were seeded per well of a 96-well plate. 400 FACS sorted ILC1 were cultured on feeder cells cells at 5% CO2 in RPMI 1640+ GlutaMAX medium supplemented with 10% FCS, 1x penicillin-streptomycin, 50 μM β-Mercaptoethanol (Gibco) and 25 ng/ml murine IL-2 (Peprotech) or 25 ng/ml human IL-15 (Peprotech). After 7 days, cells were analyzed by flow cytometry. For analysis of cell proliferation, 2000 FACS sorted cells were labelled with Cell-Trace Violet (c34557; Invitrogen). Cells were stained in a 1.25 nM working solution in 1x PBS + 0.1 % (v/v) FCS and incubated in the dark for 20 min. Cells were washed three times with PBS and cultured on feeder cells at 5% CO2 in RPMI 1640+ GlutaMAX medium supplemented with 10% FCS, 1x penicillin-streptomycin, 50 μM β-Mercaptoethanol (Gibco) and 25 ng/ml murine IL-2 (Peprotech). After 4-8 days, cells were analyzed by flow cytometry.

Friedrich C., Taggenbrock R.L., Doucet-Ladevèze R., Golda G., Moenius R., Arampatzi P., Kragten N.A., Kreymborg K., de Agüero M.G., Kastenmueller W., Saliba A.E., Grün D., van Gisbergen K.P, & Gasteiger G. (2021). Effector differentiation downstream of lineage commitment in ILC1 is driven by Hobit across tissues. Nature immunology, 22(10), 1256-1267.

+ Open protocol

+ Expand

Expansion and Maintenance of T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

T cells were kept at a density of ∼10⁶ cells per ml cell culture medium. The T-cell medium consisted of RPMI 1640 (Invitrogen), 1× penincillin/streptomycin (Invitrogen), 5% FCS, 5% human serum, 1 mM sodium pyruvate (Invitrogen), 2 mM L-glutamine (Invitrogen), 10 mM nonessential amino acids (Invitrogen), 10 mM Hepes (Invitrogen), and 16 μg/ml gentamycin (Biochrom). Human IL-7 and human IL-15 (both PeproTech) were added to the medium to a final concentration of 5 ng/ml each and replenished when fresh culture medium was added to the cells every 2–3 d. The AML cell line ML2 (The CABRI consortium) was retrovirally transduced with genes encoding firefly luciferase (fluc) or HLA-B7. Mycoplasma contamination status was regularly tested.

Albers J.J., Ammon T., Gosmann D., Audehm S., Thoene S., Winter C., Secci R., Wolf A., Stelzl A., Steiger K., Ruland J., Bassermann F., Kupatt C., Anton M, & Krackhardt A.M. (2019). Gene editing enables T-cell engineering to redirect antigen specificity for potent tumor rejection. Life Science Alliance, 2(2), e201900367.

+ Open protocol

+ Expand

Expansion of Antigen-Specific CAR-T Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

CAR-T cells were labeled with FITC-conjugated anti-human NGFR mAb (clone ME20.4) and isolated using anti-FITC microbeads (Miltenyi Biotec). Isolated CAR-library T cells were stimulated with the K562-based APCs established as above at an E/T ratio of 20:1^{35 (link)–37 (link)}. To expand the A2/NY-ESO-1₁₅₇-specific CAR-library T cells, A2-APCs were pulsed with 10 μg/mL NY-ESO-1₁₅₇ peptide, irradiated, and the floating peptide was removed to stimulate T cells. To expand the CD19-specific CAR-library T cells, CD19-APCs were utilized without loading any peptides. These CAR-library T cells were cultured in RPMI1640 supplemented with 50 μg/mL gentamicin and 10% human AB serum in the presence of 10 IU/mL human IL-2 and 10 ng/mL human IL-15 (PeproTech). Following three stimulations, antigen-specific CAR-library T cells were used for analyses. In some experiments, newly identified CD19 CAR-T cells as well as the original CD19 CAR-T cells were stimulated with Raji cells (E/T 1:1) or CD19-APCs (E/T 10:1). After stimulation, the proliferation activity of the CD19 CAR-T cells was assessed by calculation of the fold increase.

Ochi T., Maruta M., Tanimoto K., Kondo F., Yamamoto T., Kurata M., Fujiwara H., Masumoto J., Takenaka K, & Yasukawa M. (2021). A single-chain antibody generation system yielding CAR-T cells with superior antitumor function. Communications Biology, 4, 273.

+ Open protocol

+ Expand

Expansion and Activation of NK Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

PBMCs from healthy donors (buffy coats provided by DRK Blutspendedienst, Frankfurt, Germany) were enriched using density gradient centrifugation with Histopaque-1077 (Sigma-Aldrich, Taufkirchen, Germany). NK cells from PBMCs were enriched using a negative selection kit following the manufacturer’s instructions (EasySep™ Human NK Cell Enrichment Kit; STEMCELL Technologies, Cologne, Germany). NK cells were expanded and activated in NK-MACS (Miltenyi Biotec, Bergisch Gladbach, Germany) supplemented with human IL-15 (Peprotech, Rocky Hill, CT) for 15 days. The NK cell population purity was validated to be above 95% after enrichment (day 0), during expansion (day 7) and on the day of experiments (day 15) using a flow cytometric staining panel. NK cells were defined as CD56 and CD16 double-positive and CD3 negative.

Särchen V., Reindl L.M., Wiedemann S., Shanmugalingam S., Bukur T., Becker J., Suchan M., Ullrich E, & Vogler M. (2023). Characterization of BV6-Induced Sensitization to the NK Cell Killing of Pediatric Rhabdomyosarcoma Spheroids. Cells, 12(6), 906.

+ Open protocol

+ Expand

Generation and Transduction of Anti-Mesothelin CAR T Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The anti-mesothelin M5 4-1BB-zeta CAR was previously described (25 (link), 29 (link), 30 ). CD4 and CD8 T cells were combined at a 1:1 ratio and rested overnight with R10 media supplemented with 5ng/mL human IL7 and 5ng/mL human IL15 (Preprotech). The next day, CRISPR-Cas9 editing was performed, and cells were cultured in cytokine-supplemented R10 media at 5 × 10⁶ cells/mL at 37 °C and activated 4 to 6 h later with Dynabeads® CD3/CD28 CTS™ (Thermofisher) at a 3:1 bead-to-cell ratio at 1 × 10⁶ cells/mL. After 24 h, T cells were transduced at a multiplicity of infection (MOI) of 3. At day 5, beads were removed from cultures. T cell cultures were maintained at 6 × 10⁵ cells/mL. Cell number and volume were monitored daily using Multisizer 3 Coulter Counter (Beckman). Transduced T cells were cryopreserved when they reached a rested state, as determined by cell volume.

Mai D., Johnson O., Reff J., Fan T.J., Scholler J., Sheppard N.C, & June C.H. (2023). Combined disruption of T cell inflammatory regulators Regnase-1 and Roquin-1 enhances antitumor activity of engineered human T cells. Proceedings of the National Academy of Sciences of the United States of America, 120(12), e2218632120.

+ Open protocol

+ Expand

Modulation of NK and Macrophage Cytotoxicity

Check if the same lab product or an alternative is used in the 5 most similar protocols

NK cell killing assays and macrophage killing assays were performed on the XCelligence SP platform and MP platform (ACEA Biosciences). Special 96-well E-plates (ACEA Biosciences) were coated with collagen (Sigma-Aldrich) and 4 × 10⁵ WT, B2M⁻^/⁻CIITA⁻^/⁻, or B2M⁻^/⁻CIITA⁻^/⁻ CD47 tg (pooled or single clones) hiECs were plated in 100 µl cell-specific medium. After the cell index value reached 0.7, human NK cells or human macrophages were added at an E:T ratio of 0.5:1, 0.8:1, or 1:1 with or without 1 ng/ml human IL-2 or human IL-15 (both from PeproTech). In some cases, NK cells were pretreated with human FcR block (catalog no. 130–059-901, concentration 1:5; Miltenyi) for 4 h before addition of target cells. As a negative control, cells were treated with 2% Triton X-100 in cell-specific media (data not shown).
Some wells were pretreated with an anti-CD47 blocking antibody (10 µg/ml, clone B6.H12, mouse IgG1,κ; BioXCell) for 2 h and during the assay or with an anti-SIRPα blocking peptide (2 µg/ml, catalog no. MBS822365; MyBioSource) for 2 h and during the assay. In some cases, cells were treated with an activating anti-LILRB1 antibody (clone GHI/75, mouse IgG2b; Abcam) at a concentration of 1 µg/ml. Data were standardized and analyzed with the RTCA software (ACEA Biosciences).

Deuse T., Hu X., Agbor-Enoh S., Jang M.K., Alawi M., Saygi C., Gravina A., Tediashvili G., Nguyen V.Q., Liu Y., Valantine H., Lanier L.L, & Schrepfer S. (2021). The SIRPα–CD47 immune checkpoint in NK cells. The Journal of Experimental Medicine, 218(3), e20200839.

+ Open protocol

+ Expand

Activation and Expansion of Primary Human T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood mononuclear cells (PBMCs) were collected from healthy voluntary donors and isolated from the whole blood via Ficoll-Paque PLUS density gradient centrifugation (cat# 17144002, cytiva). CD3⁺ T cells were isolated using the Pan T cell isolation kit (cat# 130-096-535, Miltenyi Biotec). Next, the isolated CD3⁺ T cells were stimulated for 48 h with the human T cell activation/expansion kit (cat# 130-091-441, Miltenyi Biotec) in accordance with the manufacturer’s instructions. For this process, the T cells were cultured in X-VIVO™ 15 media (cat# 02-060Q, Lonza) supplemented with 10% inactivated FBS, 10 ng/mL human IL-7 (cat# 200-07, Peprotech), and 10 ng/mL human IL-15 (cat# 200-15, Peprotech) at a final concentration of 1 × 10⁶ cells/mL.

Lu Q., Li H., Wu Z., Zhu Z., Zhang Z., Yang D, & Tong A. (2024). BCMA/CD47-directed universal CAR-T cells exhibit excellent antitumor activity in multiple myeloma. Journal of Nanobiotechnology, 22, 279.

+ Open protocol

+ Expand

Isolation and Activation of Human T Cells

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood was obtained from the healthy donors. Blood sampling was performed following the required ethical procedures. Lymphocytes were isolated by density gradient centrifugation following the manual of the Human Lymphocyte Separation Medium (DAKEWE). Human T cells were purified using the human CD3 T cell isolation kit (BioLegend), stimulated with CD3/CD28 T cell Activator Dynabeads (Gibco) and cultured at 10⁶/mL in X-VIVO 15 Serum-free Hematopoietic Cell Medium (Lonza), supplemented with 5 ng/mL human IL-7 (PeproTech) and 5 ng/mL human IL-15 (PeproTech)^{40 (link),65 (link)}, with slight modification. 48 h after T cell stimulation, T cells were transduced with lentiviral supernatants from 293 T cell line in the presence of polybrene (6 μg/mL, Yeasen) by centrifugal infection. T cells were analyzed by flow cytometry 4 days after transduction and were used for further experiments. All human subjects were informed and signed informed consent prior to inclusion in the study and all human cell isolation and related experiments were approved by the Ethics Committee for Human Studies of Second Affiliated Hospital of Zhejiang University School of Medicine (2019 NO.388).

Chen S., Chen G., Xu F., Sun B., Chen X., Hu W., Li F., Syeda M.Z., Chen H., Wu Y., Wu P., Jing R., Geng X., Zhang L., Tang L., Li W., Chen Z., Zhang C., Sun J., Chen W., Shen H, & Ying S. (2022). Treatment of allergic eosinophilic asthma through engineered IL-5-anchored chimeric antigen receptor T cells. Cell Discovery, 8, 80.

+ Open protocol

+ Expand

Generating CCL1 Knockout T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Murine T cells have been differentiated from splenocytes from donor mice. T cell isolation and transduction have been previously described (47 (link)) and then expanded or directly expanded with T cell medium supplemented with human IL-15 (PeproTech) every second day. Human T cells have been differentiated and transduced using previously described protocols (39 ) or directly taken into culture with human T cell medium in concentrations of 10⁶ T cells per milliliter medium. CCL1 knockout human T cells were generated using a two-component guide RNA (gRNA) CRISPR method as previously described (48 (link)) after magnetic removal of DynaBeads, using the EH-115 pulse code on a 4D-Nucleofector (Lonza). gRNAs [crRNA (Trans-activating CRISPR RNA) CCL1 AA: TGTAACACAGGATTGCCCTCAGG; and crRNA CCL1 AF: CGGAGCAAGAGATTCCCCTGAGG) were selected from CHOPCHOPv3 (49 (link)), synthesized by IDT (Integrated DNA technologies), and used simultaneously for human CCL1 knockout. T cells were used in experiments 5 days after genetic modifications.

Cadilha B.L., Benmebarek M.R., Dorman K., Oner A., Lorenzini T., Obeck H., Vänttinen M., Di Pilato M., Pruessmann J.N., Stoiber S., Huynh D., Märkl F., Seifert M., Manske K., Suarez-Gosalvez J., Zeng Y., Lesch S., Karches C.H., Heise C., Gottschlich A., Thomas M., Marr C., Zhang J., Pandey D., Feuchtinger T., Subklewe M., Mempel T.R., Endres S, & Kobold S. (2021). Combined tumor-directed recruitment and protection from immune suppression enable CAR T cell efficacy in solid tumors. Science Advances, 7(24), eabi5781.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!