Lightcycler 96 real time pcr

Total RNA was extracted from cultured astrocytes by using an RNeasy Mini Kit (74104; QIAGEN) according to the manufacturer’s protocols. cDNA was prepared by using a Transcriptor First Strand cDNA Synthesis Kit (04897030001; Roche). The mRNA expression levels were assessed with real-time PCR by using FastStart Essential DNA Green Master (06924204001; Roche). A fragment of Actin was amplified as the internal control. The sequences of the forward (F) and reverse (R) primers used to amplify AMFR, SP1, MAZ, FOXA3, DPF2, and Actin were as follows: AMFR (F), 5′-ATGGAGGCCAGGTTTGCAG-3′, and AMFR (R), 5′-TGCATGTTGGACAGGAGGTG-3′; SP1 (F), 5′-GGGAAACGCTTCACACGTTC-3′, and SP1 (R), 5′-ACCTGGGCCTCCCTTCTTAT-3′; MAZ (F), 5′-AGGACCGCATGAGTTACCAC-3′, and MAZ (R), 5′-AAGCTGCCTCACATTTCTCAC-3′; FOXA3 (F), 5′-AGTGCCTGTAGAGAGACCGA-3′, and FOXA3 (R), 5′-TCACTGGAGAATACACCTCGC-3′; DPF2 (F), 5′-GAGCACGGAAGCGGATCAT-3′, and DPF2 (R), 5′-CATAGGGCTTATCCCGGTCC-3′; Actin (F), 5′-CATGTACGTTGCTATCCAGGC-3′, and Actin (R), 5′-CTCCTTAATGTCACGCACGCACGAT-3′. All reactions were run on a Roche LightCycler 96 real-time PCR instrument. A total of 3 biological replicates and 3 technical replicates were performed for each group. The data were analyzed using the comparative 2^-ΔΔCt method.

Total cellular RNA was isolated from 50 to 100 mg homogenized adipose tissue samples using TRIzol reagent (Invitrogen). cDNA was synthesized from 1,000 ng of total RNA using cDNA synthesis kit (Roche). DPP4 gene expression was analyzed by quantitative PCR (LightCycler 96 real time PCR, Roche) using SYBR Green master mix (FastStart Universal SYBR Green Master, Roche) with following primers—forward 5′AAGTGGCGTGTTCAAGTGTG3′ and reverse 5′GGCTTTGGAGATCTGAGCTG3′. Relative gene expression was analyzed by ΔΔCt method and normalized by 18S RNA.

To verify the transcriptome data, the ef1a gene (GenBank accession no. AB061263) was selected as the endogenous reference gene. There were 17 upregulated DEGs (UR) and six downregulated DEGs (DR) selected for qRT-PCR verification. Total RNA was extracted using the RNA Easy Fast Plant Tissue Kit (TIANGEN, DP452) following the manufacturer’s instructions. The integrity of total RNA was analyzed by 1.0% agarose gel electrophoresis. The information about primer sequences of selected DEGs (Supplementary Table 1) was designed using NCBI (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) and synthesized by Sangon Biotech (Shanghai, China). First-strand cDNA was synthesized using the FastKing cDNA Synthesis Kit (TIANGEN, KR118-03) following the manufacturer’s instructions. The qRT-PCR gene expression was inspected using a SuperReal PreMix Plus (SYBR Green) (TIANGEN, FP205-03). Reactions were carried out on a LightCycler (LightCycler96 Real-Time PCR, Roche, Switzerland) by the default cycling conditions (15 min at 95°C and 40 cycles of 10 s at 95°C, 20 s at 60°C, 30 s at 72°C and 95°C for 15 s, 60°C for 1 min). The melting curve analysis was used to examine the specificity of each amplification, and the relative expression levels were calculated by the 2^−ΔΔCt quantitative method (Ct, cycle threshold value of target gene) (Willems et al., 2008 (link)).

Each isolate was genotyped using a high resolution melt (HRM) technique adapted from the method described by Bratchikov and Mauricas (2011) (link). The precise melting curves of three genomic regions, two CRISPRs (cr1 and cr2) and one VNTR (yohm), were analyzed after PCR amplification using a LightCycler 96 real time PCR (Roche diagnostics, Mannheim, Germany). The combined analysis of these three curves was associated with an HRM type. A variation in the melting curve profile from one of these three regions was considered to reveal a new HRM type. Representative isolates of each of the different types were serotyped by the veterinary epidemiosurveillance laboratory of the Ministère de l’Agriculture, des Pêcheries et de l’Alimentation du Québec.

Total RNA was isolated with TRIzol (Invitrogen, Carlsbad, CA, USA) and 2 µg of total RNA was used for cDNA synthesis using a high capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA). Purity of isolated total RNA was measured by using the ratio of absorbance at 260 nm and 280 nm (A260/A280), and the ratio of A260/A280 higher than 1.8 was considered to be of acceptable purity. To analyze the gene expression, quantitative PCR was performed using the SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and LightCycler96 real-time PCR (Roche, Basel, Switzerland). Ct values were normalized to the human 36B4 gene and relative mRNA expression was calculated versus human 36B4 expression as previously described [36 (link)]. The primer sequences used in the experiment are shown in Table 1.