Annealing buffer for dna oligos

The RPA primers were selected in the conserved nucleotide region of the E gene. The T7 promoter sequence (GAAATTAATACGACTCACTATAGGG) was appended to the 5′ end of the RPA forward primer. For crRNA preparation, the DNA templates of crRNA were appended with the T7 promoter sequence and synthesized as primers by General Biological System (Anhui) Co. (Table 1). The FAM-N6-BHQ1 probe used in the fluorescent reporter assays was synthesized by General Biological System (Anhui) Co. Two oligonucleotides were annealed to a double‐stranded DNA by using Annealing Buffer for DNA Oligos (Beyotime, China). The double-stranded DNA was purified by gel extraction. According to the instructions of the HiScribe T7 Quick High Yield RNA Synthesis kit (NEB, USA), the double-stranded DNA was transcribed to crRNA. Finally, crRNA was purified using NucAway™ Spin Columns (Invitrogen, USA) according to the manufacturer’s instructions and stored at −80°C.

The amino acid sequences of PCV4-Cap genes from 38 PCV4 field strains were examined using multiple sequence alignments. A conserved 307 base pair nucleotide sequence template (Supplementary Material 1) was chosen to design RPA primers per design requirements. The T7 promoter sequence (GAAATTAATACGACTCACTATAGGG) was appended to the 5′ end of the RPA forward primer. Five primer sets were designed. Primers were synthesized by General Biological System Co., (Anhui, China) (Table 1).
In total, five Cas-13a crRNAs targeting the RPA amplification products of the Cap gene were designed. For crRNA preparation, crDNA templates were appended to the T7 promoter sequence and synthesized as primers by General Biological System Co., (Table 1). Two oligonucleotides were annealed to double-stranded DNA (ds-DNA) using annealing buffer for DNA Oligos (Beyotime, China), and then the ds-DNA was purified by gel extraction. In accordance with the instructions of the manufacturer, the ds-DNA was transcribed to crRNA using the HiScribe T7 Quick High Yield RNA synthesis kit (NEB, Massachusetts, USA). The crRNA was purified using the Agencourt RNAClean XP kit (Beckman Coulter, CA, USA) and stored at −80 °C. The FAM-N6-BIO probe (FB probe), used in fluorescent reporter assays, was synthesized by General Biological System Co., (Table 2).

Electrophoretic mobility shift assays (EMSAs) were conducted using the LightShift Chemiluminescent EMSA Kit (Thermo Scientific). MdAGO4‐1/2 were cloned into the expression vector pET32a. The AGO4‐1/2 recombinant protein was expressed in E. coli strain BL21 (DE3) and purified using a Ni‐agarose His‐Tagged Protein Purification Kit (CW Biotech). All promoter probes were synthesized and labelled by the Sangon Biotech Co. Double‐stranded probes were synthesized using annealing buffer for DNA oligos (Beyotime, Shanghai, China). The partial primers used for EMSAs are listed in Table S1.