To detect the deletion, genomic DNA was extracted from lymphocytes/epithelial cells, and the relevant region of the ERCC1 gene was amplified in a qPCR. qPCR was performed using probes and specific primers (listed in Table S1 ) designed using the Universal ProbeLibrary Assay Design Center (Roche) and synthesized by Sigma-Aldrich. The primers were designed to include the deleted region in exon 4 and a region within the gene that is not deleted as control (exon 5). A multiplex qPCR using the LightCycler R 480 Probes Master reaction mix (Roche) was performed according to the manufacturer’s protocol to amplify and quantify the ERCC1 gene region, using the CFTR gene (exon 27) as an internal standard (Table S1 ). The qPCR was performed on the LightCycler R 480 instrument (Roche), and data analysis was performed using the LightCycler R 480 software version 1.5.0 (Roche). American College of Medical Genetics guidelines were followed for interpretation of sequence variation (http://www.acmg.net ).
Lightcyclerr 480
Manufactured by Roche
Sourced in Switzerland
The LightCyclerR 480 is a real-time PCR (Polymerase Chain Reaction) instrument designed for quantitative and qualitative nucleic acid analysis. It is capable of performing high-throughput sample processing and data analysis. The core function of the LightCyclerR 480 is to amplify and detect specific DNA or RNA sequences in a sample.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt master mix, by Takara Bio (7 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (6 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Trizol reagent, by Takara Bio (5 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Lightcycler 480 sybr 1 master mix, by Roche (2 mentions)
Lightcyclerr 480 probes master mix, by Roche (2 mentions)
Trizol, by Takara Bio (2 mentions)
Takyon master mix, by Eurogentec (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Sybr premix ex taq 2, by Takara Bio (2 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
Sybr green reaction mix, by Takara Bio (1 mentions)
Sybr premix ex taqtm, by Takara Bio (1 mentions)
Sybr green pcr master mix, by Takara Bio (1 mentions)
Mhcc97 h, by BNCC (1 mentions)
Primescript rt master mix kit, by Takara Bio (1 mentions)
Tb green premix ex taq, by Takara Bio (1 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (1 mentions)
Amplification grade dnase 1, by Merck Group (1 mentions)
23 protocols using lightcyclerr 480
1
ERCC1 Gene Deletion Detection
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (1.5 μg) from hippocampal samples from the experimental groups (WT_Y, KO_Y, WT_AU, WT_AI and KO_A) (n = 5–8 per group including overlap with animals used in microarray) was reverse transcribed into cDNA with oligo(dT) primers using the QuantiTect Reverse Transcription Kit (Qiagen) in accordance with the manufacturer's instructions. Gene‐specific mRNA levels were determined in cDNA samples incubated in triplicate with gene‐specific primers and fluorescent probes (using pre‐designed assays from Applied Biosytems, Warrington, UK) in a 1 × Roche LightCyclerR 480 Probes mastermix (Roche, Basel, Switzerland). PCR cycling and detection of fluorescent signal were carried out using a Roche LightCyclerR 480 (Roche). A standard curve was constructed for each primer probe set using a serial dilution of cDNA pooled from all samples. The primers (Invitrogen) were designed for use with intron‐spanning probes from the Roche Universal Probe Library. Software provided with the LightcyclerR 480 was used to analyse the data produced after RT‐PCR. All results were corrected by normalisation to the expression level of the reference (housekeeping) gene Gapdh, which did not differ between groups and expressed arbitrarily as an adjusted ratio.
3
Quantification of Gene Expression in Colon Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from colon tissue or cells using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. The reverse transcription (cDNA) was synthesized from 1 μg of total RNA with Prime Script RT Master Mix (Takara Biotechnology, Dalian, China). Quantitative Real-time PCR was performed using 1 μl first-strand cDNA with the LightCycler® 480 SYBR I Master Mix (Roche, Switzerland), in a final volume of 10 μl. All samples were run in triplicate and underwent 45 amplification cycles in a Roche LightCycler R480 (Roche, Switzerland). The relative fold change of mRNA expression was measured by using 2−ΔCT method and normalized. Primers used can be seen on Additional file 1 : Table S1.
4
Quantifying Gene Expression in Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA of tissues (20 mg of colon tissues [a random segment of colon], 20 mg of liver tissues, and 20 mg of muscle tissues) was isolated using 700ul of TRIzol reagent (Takara, Otsu, Japan,) and then reverse transcribed to cDNA by Prime Script™ RT Master Mix (Perfect Real‐Time; Takara, Otsu, Japan). Quantitative polymerase chain reaction (PCR) amplification was performed with a 10 μL final reaction mixture consisting of 1 μl cDNA, 5 μl SYBR‐Green reaction mix (Takara, Otsu, Japan), 0.5 μl of each sense and antisense primer (both from Invitrogen), and 3 μl of sterile water performed by the Roche LightCycler R480 (Roche, Switzerland). The PCR conditions were initial denaturation at 95°C for 5 min and followed by 45 cycles of PCR reaction: denaturation at 95°C for 20 s, annealing at 58°C for 30 s and elongation at 72°C for 30 s. Gene expression was normalized by GAPDH level and relative changes in target gene expression were determined using the 2−ΔCt method (ΔCt = CT target gene ‐ CT GAPDH). The Primer sequences as shown in Table 2 .
5
Gene Expression Analysis in Colonic Tissues and Organoids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both colonic tissues and intestinal organoids were harvested after treatment. Briefly, total RNA was isolated with TRIzol (TaKaRa, Dalian, China). Complementary DNAs (cDNAs) were obtained by reverse transcription using PrimeScript™ RT Master Mix (TaKaRa, Dalian, China). Gene expression was detected through amplification of cDNA fragments with SYBR Premix Ex TaqTM (TaKaRa) on a Roche LightCycler R480 (Roche, Switzerland). The relative expression levels of genes were normalized to the housekeeping gene GAPDH. All mRNA primer sequences are listed in Supplementary Table S1 .
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from colon tissue or cells using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. Reverse transcription (cDNA) was synthesized from 1 μg of total RNA with Prime Script RT Master Mix (Takara Biotechnology, Dalian, China). Quantitative Real-time PCR (qPCR) was performed using 1 μl of first-strand cDNA with the LightCycler® 480 SYBR I Master Mix (Roche, Switzerland) at a final volume of 10 μl. All samples were run in triplicate and underwent 45 amplification cycles on a Roche LightCycler R480 (Roche, Switzerland). The relative fold-change in mRNA expression was measured by using the 2−ΔCT method and normalized. The primers used are listed in Additional file 1 : Table S1.
7
Quantitative Analysis of Gene Expression in Liver Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human hepatocyte cell line MIHA and HCC cell lines, MHCC-97H and Huh-7, were obtained from the BeNa Culture Collection (Suzhou, China), and cultured in Dulbecco’s modified Eagle medium with 10% fetal bovine serum in a 37 °C humidified incubator containing 5% CO2. Total RNA was isolated from cells using the TRI-ZOL reagent (Takara, Otsu, Japan). Then, the cDNA synthesis was performed using the PrimeScript™ RT Master Mix Kit (Takara). Real-time polymerase chain reaction (RT-PCR) was carried out using the SYBR-Green PCR master mix (Takara) in the Roche Light Cycler R480 (Roche, Basel, Switzerland). The Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal reference. The relative expression of mRNA levels was calculated by 2−ΔΔCt and the primer sequences are listed in Table S2 .
8
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells or tissues using Trizol reagent (TaKaRa, Shiga, Japan). The RNA purity and concentration were determined according to the ratio 260/280 nm in a UV spectrophotometer. Total RNA was reverse transcribed into cDNA using the Revert Aid First Strand cDNA synthesis Kit (Thermo). qRT-PCR detection was subsequently performed using LightCyclerR 480 (Roche, Switzerland). The expression of Gapdh was used to normalize the gene expression levels. The primers of target genes were: IL-1β_F, CCGTGGACCTTCCAGGATGA; IL-1β_R, GGGAACGTCACACACCAGCA; IL-6_F, CTGCAAGAGACTTCCATCCAG; IL-6_R, AGTGGTATAGACAGGTCTGTTGG; TNF-α_F, CATCTTCTCAAAATTCGAGTGACAA; TNF-α_R, TGGGAGTAGACAAGGTACAACCC; MCP-1_F, TAAAAACCTGGATCGGAACCAAA; MCP-1_R, GCATTAGCTTCAGATTTACGGGT; GAPDH_F, ACCCTTAAGAGGGATGCTGC; GAPDH_R, CCCAATACGGCCAAATCCGT; Serinc2_F, GACTCTTTGTGTAACTGGCATC; Serinc2_R, AGCTTGTAAAGCTGACTCTCCA.
9
Investigating TRPV1 and TRPV4 Expression in hMGECs under Inflammatory and Hyperosmolar Conditions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The effect of simulated inflammatory and hyperosmolaric conditions (as they occur during DED [7 (link)]) on TRPV1 and TRPV4 expression on proliferating and differentiated hMGECs was investigated using qPCR. The cells were stimulated with 10 ng/mL IL1ß or 10 ng/mL TNFα for 6 h and 24 h, as well as with hypotone (medium diluted 1:1 with a.d.) and hypertone medium (concentrations of 450, 500, 550 mOsm NaCl) for 24 h. Takyon MasterMix (Eurogentec, Seraring, Belgium) was used according to manufacturer’s instructions and duplicates of four biological replicates were amplified and analyzed using a LightCyclerR 480 (Roche, Basel, Switzerland). A no-template control served as the negative control. Data were analyzed according to ddCt analysis by Pfaffl [68 (link)].
10
Fluorescence qPCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fluorescence quantitative PCR was performed as previously described (11 (link), 12 (link)). Total RNA was extracted from NRVM cells using Trizol reagent (TaKaRa, Shiga, Japan). RNA was quantified using NanoDrop (Thermo Fisher Scientific, USA). The first strand cDNA was synthesized using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA), and SYBR Green PCR Master Mix (Monad, Suzhou, China) was used to perform fluorescent quantitative PCR. Finally, relative mRNA expression levels were analyzed by real-time qRT-PCR using LightCyclerR 480 (Roche, Switzerland). The primer sequence used for amplification was shown in Table 2 . And the mRNA content of endogenous β-actin was set as a control to quantify the relative expression level of the target gene.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!