Ezh2 antibody

Chromatin immunoprecipitation assay (ChIP) assays were performed using an EZ-CHIP KIT (Millipore). EZH2 antibody was obtained from Abcam. H3 trimethyl Lys 27 antibody was from Millipore. The ChIP primer sequences are listed in Supplementary Table 1. Quantification of immunoprecipitated DNA was performed using qPCR with SYBR Green Mix (TaKaRa). ChIP data were calculated as a percentage relative to the input DNA by the equation of 2^{(Input Ct - Target Ct)} × 0.1 × 100.

ChIP assay was performed as described previously.¹¹ (link) ChIP was carried out by the ChIP Assay Kit (Millipore, USA). In brief, 10⁷ AC16 cells were cross-linked with 37% formaldehyde and 1.5 M glycine. Nuclei were obtained after lysis and centrifugation. The nuclear components were extracted with nuclei lysis buffer and then obtained the DNA fragment by ultrasonic breaker (Scientz, China). The supernatant was collected, and the total volume was recorded. Then the supernatant was incubated with IgG antibody (Sigma, #SAB3700848), H3K27me3 antibody (Cell Signaling Technology, # 9733) or EZH2 antibody (abcam, # ab3748) at 4°C overnight separately. 1% supernatant was taken as input and stored at 4 °C. Then pre-cleaning G-sepharose were added into the mixture and incubated at 4 °C for 90 min. After centrifugation, the supernatant was removed and beads were washed repeatedly. IP elution buffer was added to the beads and the process of de-crosslinking was performed by heating at 65 °C overnight. Finally, DNA were extracted for qRT-PCR analysis. The primer sequences were as follows: Forward primer, 5ʼ- AGCAGGCATCCATGAAATGT-3ʼ, Reverse primer, 5ʼ- AAGTGGTTCACCAAGTGCAA -3ʼ.