Hot start taq

Total mRNA was obtained from brain samples using TRIzol (Ambion, Carlsbad, CA, USA) according to the manufacturer´s protocol. Genomic DNA was depleted using the Mini RNeasy kit (Qiagen). cDNA was synthesized from purified mRNA by reverse transcription using Superscript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer´s instructions. For qPCR cDNA amplification, Hot Start Taq (New England Biolabs, Ipswich, MA, USA) was used with SYBR Green for amplicon detection. All primers were used with an optimal efficiency rate of 2.0 ± 0.05. Runs were performed on a Lightcycler 96 (Roche Bioanalytics, Basel, Switzerland). Primers used in this study were (5′ to 3′): Cbln1: GCTTTCTCTGCCATCAGG and TCTGAGTCAAAGTTGTTCCC, Grid2: TGACACCATGAGGATAGAGG and ACCTCACTTATGAAGGATTTGG, 18S: GAAACTGCGAATGGCTCATTAAA and CCACAGTTATCCAAGTAGGAGAGGA.

Total mRNA was obtained from brain samples using TRIzol (Ambion) according to the manufacturer's protocol. DNA was depleted using the Mini RNeasy kit (Qiagen, Germany). cDNA was synthesized from purified mRNA by reverse transcription using Superscript III reverse transcriptase (Invitrogen) and random primers according to the manufacturer's manual. For qPCR cDNA amplification, Hot Start Taq (New England Biolabs, MA, USA) was used with SYBR Green for amplicon detection. All primers were used with an optimal efficiency rate of 2.0±0.5. Target gene signal was normalized to Ppia as reference gene using the comparative ΔΔC_T method (Schmittgen and Livak, 2008 (link)). Normalization to 18S gave similar results. Runs were performed on a Lightcycler 96 (Roche Bioanalytics, Germany). Primers used in this study were (5′ to 3′): Scn1a, GAATCCCAAGCCAGACAAA and ACCATCTCTGGAGGAATGT; Scn2a, ACAGGAATTTATACTTTTGAATCA and AGTATCATGACGTCAGACAG; Scn8a, CTTCAGTGTCATCATGATGG and GCCCACGATTGTCTTCA; Gabra2, GAAAGGCTCCGTCATGATAC and GCTTGTTCTCTGGCTTCTT; Gabbr2, CTACGACGGTCTTACTCTCA and GGCCTCTCTCCTTTGTCTA; Pum2, AGCAACCAAGCACTAACC and CCAGGTCCATGAGAGAATAAAG; Ppia, GTCAACCCCACCGTGTTCTT and CTGCTGTCTTTGGAACTTTG; and 18S, GAAACTGCGAATGGCTCATTAAA and CCACAGTTATCCAAGTAGGAGAGGA.

Total RNA from clinical tissue samples was extracted using TRIzol® Plus RNA Purification System (Life Technologies, Paisley, UK) according to the manufacturer’s instructions. The quantity of total RNA was determined by NanoDrop ND-1000 (ThermoFisher Scientific, UK). Total RNA was reverse transcribed using AMV First Strand cDNA synthesis kit (New England Bio Labs, Hertfordshire, UK). cDNA was amplified by PCR using HotStart Taq (New England Bio Labs, Hertfordshire, UK).
TRIzol® Reagent (Life Technologies) was used to isolate total RNA which was precipitated from samples according to the manufacturer’s instructions. Total RNA was extracted from whole tissue, SSEA1 sorted (MACS) cells and treated/untreated Ishikawa cells (positive control) and reverse-transcribed into cDNA using the Superscript III First-Strand Synthesis System (Invitrogen).