Amaxa nucleofector 2 device

Neurospheres were electroporated with 7.5 μg of the indicated plasmids using the Amaxa mouse NSC Nucleofector Kit (Lonza) and the Amaxa Nucleofector II Device (Lonza) according to the manufacturer's instructions.
N2a, HEK293T and NIH3T3 cells were transfected using Turbofect (Fermentas) according to the manufacturer's instructions. Each transfection experiment was repeated at least three independent times.

FOXP1 expression was silenced in DLBCL cell lines by Nucleofection program X-001 in an Amaxa Nucleofector II Device (Lonza, Slough, UK). Briefly, 2x10⁶ cells were electroporated in Solution L supplemented with 1μm FOXP1-targeting HSS178308 (siFOXP1 #1) or HSS178309 (siFOXP1 #2) Stealth RNAi (Invitrogen, Carlsbad, CA, USA), or negative control siRNA duplex (Stealth RNAi Low GC, Invitrogen), and harvested after 48 h for western blotting and quantitative reverse-transcription PCR (qRT-PCR) analysis. Three independent experiments were performed for samples analyzed by microarray. For immune molecule fluorescence-activated cell sorting studies, OCI-Ly3 cells were subjected to consecutive rounds of silencing at 0 and 72 h, with flow cytometric analysis taking place at 144 h.

Luciferase reporter was constructed as described51 (link). Ahr promoter region (−2,000 to 0) was subcloned into pGL3 vector. Luciferase reporter vectors were cotransfected with pRL-TK (as an internal control reporter vector) into macrophages by electroporation. Luciferase assays were performed with guidelines provided by the manufacturer (Promega). For NK92 transfection, cells (1 × 10⁶) were resuspended in 100 μl Nucleofector Solution buffer (Lonza) containing 5 μg DNA, followed by transfection using the Nucleofector Program Y-001 on Amaxa nucleofector II device (Lonza). Cells were recovered in RPMI1640 media containing 4 mM L-glutamine, 1.5 g l⁻¹ sodium bicarbonate, and 10% heat-inactivated fetal bovine serum (FBS) for 6 h, followed by flow cytometry sorting for viable cells.

The full-length TcIT coding region was amplified from Dm28c gDNA, by using designated primers FTcIT (5′-GGATCCATGAACAACGTTGAGTCAAGTGACGCG-CACCT) introducing the BamHI restriction site at the 5′-end and RTcITHA (5′-AAGCTTTTAAGCGTAATCTGGAACATCGTATGGGTACGCCCACTTCCCAAGGAGCGTCATAA), with the addition of HindIII restriction site with the hemagglutinin (HA) epitope tag at the 3′-end, thus generating the TcIT-HA insert. The amplicon was subcloned into pCR2.1-TOPO vector (Thermo Fisher Scientific, Waltham, MA, USA), released by digestion with BamHI and HindIII (sites underlined above), and ligated into similarly digested expression vector pTEX (Kelly et al., 1992 (link)). The shuttle vector pTEX-TcIT-HA, which replicates in E. coli and T. cruzi, was used as the vehicle for the expression of TcIT-HA in T. cruzi. Cell electroporation was performed with an Amaxa Nucleofector II device with human T-cell buffer (Lonza, Basel, Switzerland). A total of 5 × 10⁷ epimastigotes were transfected with pTEX-TcIT-HA or empty pTEX (pTEX-Ø) vectors (10 μg DNA). After electroporation, the cells were cultured for 48 h in standard medium and 500 µg/ml G418 (Sigma-Aldrich) was added. Non-DNA control cells died after 3 to 4 weeks. Cultures were 5-fold diluted with fresh G418-containing medium after 5–10 days. Stable resistant cells were obtained ~30 days after transfection, indicating resistance to G418.

Immediately after tritium contamination, cells were washed in PBS three times, harvested and nucleofected with a 5-(and-6)-carboxy-2′,7′-dichlorodihydrofluorescein diacetate probe (carboxy-H2DCFDA) provided by Invitrogen (Life Technology, Cergy Pontoise, France). Nucleofection was optimized from Amaxa protocols for CHO cell lines and performed with Amaxa Nucleofector II Device (Lonza, France). Nucleofected cells were then analyzed by flow cytometry (FACScalibur, Becton-Dickinson) to measure fluorescence. Statistical analyses were performed with FlowJo software (Tree Star, Inc. Ashland, OR, USA).

BON cells were cultured in flasks with a 1:1 solution of DMEM and F12K supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin and maintained at 37 °C in a humidified incubator with 5% CO₂. All cell culture reagents were obtained from Life Technologies, unless specifically indicated. For cell transfection, 5 × 10⁶ BON cells were electroporated with plasmid vectors containing shRNAs against Orai1 or Orai3 (OriGene Technologies) using the Amaxa nucleofector II device (Lonza) as per manufacturer’s instruction. All available shRNA constructs supplied by the manufacturer resulted in comparable knockdowns for each subunit, and the data from these experiments were pooled. Transfection efficiency was estimated to be approximately 90% for both constructs. Control cells were transfected with an identical plasmid that contained a scrambled message. Moreover, mock-transfected and untransfected cells were used as additional controls. All plasmids expressed either GFP or RFP and a gene for puromycin resistance. Transfected cells were maintained 2 days in culture medium containing 0.2 μg/ml puromycin dihydrochloride. In addition to western blotting (see below), knockdown of Orai1 and 3 were functionally verified using live cell Ca²⁺ imaging at different time points and the maximum effects were observed at 48 h after transfection.

For this genetic manipulation of cells, we used published protocols [29 (link),55 (link)]. We used siRNAs at the following concentrations: β-catenin (100 pmol; Cell Signaling Technology, Frankfurt, Germany, #6225), MYC (100 pmol; Santa Cruz, Heidelberg, Germany, sc-29226), and WT1 (100 pmol; Santa Cruz, Heidelberg, Germany, sc-36846). Cells were electroporated with Amaxa™ Nucleofector™ II device using kit L (Lonza, Cologne, Germany, vca-1005) or with the Neon™ Transfection System (Invitrogen, Carlsbad, CA, USA). Cells were analyzed 48 h after electroporation.