Chemicals including Minimum Essential Medium Eagle (MEM), Roswell Park Memorial Institute Medium (RPMI), penicillin, ampicillin, streptomycin, Fetal Bovine Serum (FBS), O-Nitrophenyl-β-D-galactopyranoside (ONPG), p-Nitrophenyl phosphate disodium salt hexahydrate (PNPP), Histidine, De Man Rogosa and Sharpe (MRS) media, Glycerol, MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide were purchased from Hi-media, Mumbai, India. 4-Nitroquinoline N-oxide (4-NQO), Hexadecane, N,N-Dimethyl dihydrazine dihydrochloride (DMH), Dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich (Merck) India. Universal primers (UNI 27F-5′ AGAGTTTGATCCTGGCTGAG 3′, UNI 1492R-5′ GGTTACCTTGTTACGACTT 3′) were procured from Eurofins, India.
3 4 5 dimethylthiazol 2 yl 2 5 diphenyltetrazolium bromide mtt
Manufactured by HiMedia
Sourced in India
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) is a compound used in colorimetric assays to measure cell metabolic activity. It is a yellow tetrazolium salt that can be reduced by metabolically active cells to form a purple formazan product.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by HiMedia (6 mentions)
Dulbecco s modified eagle s medium dmem, by HiMedia (6 mentions)
Penicillin streptomycin, by HiMedia (3 mentions)
Propidium iodide, by Merck Group (3 mentions)
Penicillin, by HiMedia (2 mentions)
Streptomycin, by HiMedia (2 mentions)
Antibiotic solution, by HiMedia (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Ethidium bromide, by HiMedia (2 mentions)
Trypsin, by Thermo Fisher Scientific (2 mentions)
Dulbecco modified eagle medium (dmem), by HiMedia (2 mentions)
Rpmi 1640 medium, by Merck Group (2 mentions)
Collagen type 1, by Chrono-Log (2 mentions)
Leupeptin hydrochoride, by Merck Group (2 mentions)
Trypsin edta, by HiMedia (2 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (2 mentions)
Hexadecane, by Merck Group (1 mentions)
4 nitroquinoline n oxide 4 nqo, by Merck Group (1 mentions)
Universal primers, by Eurofins (1 mentions)
Ampicillin, by HiMedia (1 mentions)
25 protocols using 3 4 5 dimethylthiazol 2 yl 2 5 diphenyltetrazolium bromide mtt
1
Microbial Analysis with Diverse Chemicals
2
Comparative Cytotoxicity in A549 and V79 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A549 adenocarcinoma human alveolar basal epithelial cells and V79 Chinese hamster lung fibroblasts were purchased from the National Centre for Cell Science (NCCS), Pune. Dulbecco’s Modified Eagle’s Medium (DMEM) and antibiotic solution were purchased from HiMedia, Mumbai, India. Fetal bovine serum (FBS) was purchased from Gibco, Waltham, MA, USA. Other chemicals such as MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, acridine orange, ethidium bromide, and cholesterol were purchased from HiMedia, India. The 100 bp DNA ladder and DNA gel-loading dye (6x) were purchased from Thermo Fisher Scientific, Mumbai, India. Dimethyl sulfoxide (DMSO), chloroform, isopropanol, and ethanol were purchased from SRL chemicals, Mumbai, India.
3
Cytotoxicity Evaluation of Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dulbecco's modified eagle medium (DMEM), fetal bovine serum (FBS), antibiotic-antimycotic solution (100x), and Trypsin-EDTA solution were all purchased from Sigma Aldrich, Bangalore, India. Propidium iodide (PI), acridine orange, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and dimethyl sulfoxide (DMSO) were purchased from HiMedia, India. All other reagents used were of analytical grade and purchased from HiMedia, India.
4
MTT Assay for Cell Viability
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell suspension (200 µL) was seeded into a 96-well plate (Corning, Glendale, AZ, USA) at a cell density of (20,000 cells per well) to grow for 24 h at 37 °C with 5% CO2 (Healforce, Shanghai, China). Lipopolysaccharide (LPS) (Sigma, Mumbai, India, Cat No. L4391) or B. sacra extract at different concentrations were added to these cells and incubated for another 24 h. After removing the spent media, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (HiMedia, Mumbai, India) reagent was added to adjust the final concentration to 0.5 mg/mL. The plates were protected from light and incubated for 3 h followed by removal of MTT and addition of 100 µL of dimethylsulfoxide (DMSO) (Sigma, #PHR1309); a solubilizing agent with gentle stirring and pipetting up and down to dissolve the MTT. The absorbance was read at 570 nm wavelength to determine cell viability [56 ].
5
Cell Viability Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trypsin was procured from Gibco, USA, while Phosphate Buffered Saline (PBS), Fetal Bovine Serum (FBS), Dulbecco's Modified Eagles Medium(DMEM), 3-[4, 5-dimethylthiazol-2-yl]-2, 5 diphenyltetrazolium bromide (MTT), penicillin-streptomycin, and ethidium bromide were purchased from Hi-Media Laboratories, Mumbai, India. Rest of the chemicals employed in the study was analytical grade.
6
Graphene Oxide-Cisplatin Nanotherapeutic Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Graphene oxide, dansyl chloride, cisplatin, Nunc® Lab-Tek® II chambered coverglass, sodium dodecyl sulfate (SDS) and silicon wafers for FESEM were purchased from Sigma Aldrich. Doxorubicin was bought from Selleck Chemicals. Analytical thin-layer chromatography (TLC) was performed using 60 F254 pre-coated silica gel aluminium sheets bought from EMD Millipore Laboratories. UV-Visible spectra was recorded on Shimadzu. DMEM and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from HiMedia. MitoTracker® Deep Red, ER Tracker Green and LysoTracker Green DND-26 were purchased from Invitrogen. An Annexin-V-FITC staining kit was purchased from Roche. Flow cytometry analysis was performed on a BD-Accuri. Western blot analysis was performed on a Las ImageQuant 400.
7
Extraction and Analysis of F. vesiculosus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Grounded F. vesiculosus samples from July 2017 were purchased from Algaplus Lda. Acetone, ethanol, methanol, n-hexane, ethyl acetate, acetonitrile, dimethyl sulfoxide, and Nonidet P-40 were acquired from Fisher (Pittsburgh, PA, USA). Formic acid, PBS reagents (sodium salt, sodium chloride, potassium chloride, disodium hydrogen phosphate, and potassium dihydrogen phosphate), sodium citrate, antibiotic/antimycotic solution (100 units/mL of penicillin, 10 mg/mL of streptomycin, and 0.25 mg/mL of amphotericin B), trypsin, Roswell Park Memorial Institute (RPMI) 1640 medium, and DMEM were purchased from Sigma (St. Louis, MO, USA). Propidium iodide (PI), RNAse, and annexin V-FITC were acquired from Immunostep (Salamanca, Spain), while FBS was purchased from Lonza (Verviers, Belgium) and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) from Himedia Laboratories (Einhausen, Germany). All reagents were of analytical grade or of the highest available purity.
8
Cytotoxicity and Apoptosis Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Commercially available
chemicals and solvents were used without further purification and
distillation. Chemical reactions were carried out without any inert
gas condition. Precoated silica gel aluminum sheets 60F254 for analytical thin-layer chromatography (TLC) were obtained from
EMD Millipore Laboratories. Cell culture media (Dulbecco’s
modified Eagle’s medium (DMEM)) and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide (MTT) were purchased from HiMedia. Sodium dodecyl sulfate
(SDS), Hanks’ balanced salts, N-(2-hydroxyethyl)piperazine-N′-ethanesulfonic acid sodium salt, propidium iodide,
calcein AM, Annexin V-FITC Staining Kit and 2′,7′-dichlorofluorescein-diacetate
(DCFH-DA) were obtained from Sigma-Aldrich. MitoTracker Red CMXRos
and tetramethylrhodamine methyl ester perchlorate (TMRM) were purchased
from Thermo Fisher Scientific. All of the primary and secondary antibodies
were obtained from Cell Signaling Technology, Biolegend, and Abcam.
Confocal laser scanning microscopy was performed by a Zeiss LSM 710
machine. Flow cytometry analysis was performed using a BD FACS Calibur
flow cytometer. Each sample was done in triplicate.
chemicals and solvents were used without further purification and
distillation. Chemical reactions were carried out without any inert
gas condition. Precoated silica gel aluminum sheets 60F254 for analytical thin-layer chromatography (TLC) were obtained from
EMD Millipore Laboratories. Cell culture media (Dulbecco’s
modified Eagle’s medium (DMEM)) and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide (MTT) were purchased from HiMedia. Sodium dodecyl sulfate
(SDS), Hanks’ balanced salts, N-(2-hydroxyethyl)piperazine-N′-ethanesulfonic acid sodium salt, propidium iodide,
calcein AM, Annexin V-FITC Staining Kit and 2′,7′-dichlorofluorescein-diacetate
(DCFH-DA) were obtained from Sigma-Aldrich. MitoTracker Red CMXRos
and tetramethylrhodamine methyl ester perchlorate (TMRM) were purchased
from Thermo Fisher Scientific. All of the primary and secondary antibodies
were obtained from Cell Signaling Technology, Biolegend, and Abcam.
Confocal laser scanning microscopy was performed by a Zeiss LSM 710
machine. Flow cytometry analysis was performed using a BD FACS Calibur
flow cytometer. Each sample was done in triplicate.
9
Fluorescent Dye-Based Cellular Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rutin hydrate, Hoechst 33342, Mito Tracker (Red CMX Ros) fluorescent dye, propidium iodide (PI), and 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA) were procured from Sigma (St. Louis, MO, U.S.A.). Fetal bovine serum (FBS), Dulbecco’s modified Eagle’s medium (DMEM), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) and other reagents and chemicals were procured from HiMedia India, Ltd. (Mumbai, India). Caspase-3 and -9 activity assay kits were purchased from BioVision, U.S.A.
10
Phytochemical Extraction and Bioactivity Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mentha arvensis leaves were collected from the state of Assam, India. Silver nitrate (AgNO3), poly(ethylene glycol) (PEG) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) were purchased from Merck (India). Dulbecco’s Modified Eagle’s Medium (DMEM), Roswell Park Memorial Institute (RPMI)-1640 culture media, fetal bovine serum (FBS), penicillin–streptomycin antibiotic solution, phytohemagglutinin (PHA), 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) and radio-immunoprecipitation assay (RIPA) buffer were purchased from HiMedia (Mumbai, India). Heparin, ethidium bromide (EtBr) and trypan blue were purchased from SRL (India); poly-l-lysine, Histopaque, bisbenzimide (Hoechst 33342), paraformaldehyde, acridine orange, propidium iodide (PI), RNase, NaBH4 and anti-human primary antibodies used were procured from Sigma-Aldrich (St Louis, MO, USA). ALP-linked goat anti-rabbit secondary antibodies were purchased from Abcam (UK).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!