Human MSCs were incubated with antibiotics-free CCM in twenty 150 cm2 cell culture plates and transfected directly with miR-146a-5p inhibitor or miRNA scramble control using riboFECTTM CP transfection kit for 48 h after the cell density reached about 50% confluency. The transfected MSCs were further incubated in CCM to 80% confluency, and the CCM was replaced with CDPF for isolation of MSC-sEV containing the inhibitor (MSC-sEVinhibitor) or a scrambled miRNA (MSC-sEVscramble). Similarly, human fibroblasts were transfected with 100 nM hsa-miR-146a mimics or miRNA scramble control to produce miR-146a-enriched Fb-sEV (Fb-sEVmimics) and miRNA scrambled control-enriched Fb-sEV (Fb-sEVscramble). Fibroblasts transfected with hsa-miR-146a-5p mimics but not scramble increased expression of has-miR-146-5p in fibroblasts (Supplementary figure 2). The miRNA inhibitors, miRNA mimics and transfection kit used were all purchased from RiboBio Co., Ltd (Guangzhou, Guangdong, CN). Level of miR-146-5p in MSCs or Fb was determined by quantitative real-time PCR.
Transfection kit
Manufactured by RiboBio
Sourced in China
The Transfection kit is a laboratory product that facilitates the introduction of nucleic acids, such as DNA or RNA, into cells. It provides a simple and effective method for delivering genetic material into a variety of cell types, enabling researchers to study gene expression, perform functional analyses, and explore cellular processes.
Automatically generated - may contain errors
Lab products found in correlation
Rpmi 1640 medium, by Thermo Fisher Scientific (7 mentions)
Penicillin, by Merck Group (6 mentions)
Streptomycin, by Merck Group (6 mentions)
Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (5 mentions)
Sirna, by RiboBio (4 mentions)
Mir 185 5p mimic, by RiboBio (2 mentions)
Pcdna rab35, by RiboBio (2 mentions)
Mirna inhibitor, by RiboBio (1 mentions)
Mirna mimic, by RiboBio (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Specific sirna oligonucleotides, by RiboBio (1 mentions)
Control sirna, by RiboBio (1 mentions)
Antisense oligonucleotide aso, by RiboBio (1 mentions)
Sirna, by GenePharma (1 mentions)
Lncap, by Shanghai Zhong Qiao Xin Zhou Biotechnology (1 mentions)
Wpmy 1, by Shanghai Zhong Qiao Xin Zhou Biotechnology (1 mentions)
Du145, by Shanghai Zhong Qiao Xin Zhou Biotechnology (1 mentions)
Fetal bovine serum (fbs), by ScienCell (1 mentions)
Lipofectamine rnaimax regent, by Thermo Fisher Scientific (1 mentions)
Mir 34a 5p antagomir, by RiboBio (1 mentions)
29 protocols using transfection kit
1
Modulation of MSC-sEV and Fb-sEV by miR-146a
2
Silencing Key Regulators in Methamphetamine Exposure
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
STIM1 siRNA#1 (sequence: 5′-GGTGGTATCTATCGTG ATT-3′), siRNA#2 (sequence: 5′-GTGATACAGTGGCTGATTA-3′), Nupr1 siRNA (sequence: 5′- CAAGTTCCAGAACTCTGAA-3′), and Orai1 siRNA (sequence: 5′-GCAACGCCACAACCUCAATT-3′) were designed and purchased from Ribobio (Guangzhou, China). According to the instructions of the transfection kit (RiboBio), cells were incubated with 100 nM siRNA in antibiotic-free DMEM containing 10% FBS at 37 °C, 5% CO2 in a humidified environment. After incubation for 24 h, they were treated with METH (1.5 mM) in DMEM containing 2% FBS for 24 h.
3
Cell Transfection and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell transfection was performed using Lipofectamine 2000 (Invitrogen) and Transfection Kit (RiboBio). RT‐PCR and western blot were conducted according to previously described methods.22 Details are also provided in Appendix S1.
4
Cx43-GJs Modulation via siRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cx43-siRNA (CAGUCUGCCUUUCGUUGUA, RiboBio, Guangzhou, CN) was applied to modify the communicating function of Cx43-GJs [15 (link)]. The control group was given a sequence-scrambled siRNA as a negative control (NC-siRNA) for comparison. Following the manufacturer's instructions, siRNA transfection was performed using a transfection kit (RiboBio).
5
Sirt3 Silencing and Astragaloside IV Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The three siRNAs targeting Sirt3, negative control siRNA, and transfection kit were obtained from Ribo Biotechnology Co., Ltd. (Guangzhou, China). Transfection reagent was added to the medium to facilitate transfection, following the manufacturer's instructions. Twenty-four hours later, the efficiency of Sirt3 silencing was measured via western blotting. Sirt3-siRNA-3 exhibited the best interference efficiency and labeled the treated cells as the Sirt3-siRNA group.
The H9c2 cells were randomly divided into 5 groups: (1) Normal; (2) Model + NC-siRNA; (3) Model + Sirt3-siRNA; (4) AS-IV + Sirt3-siRNA; (5) AS-IV.
The H9c2 cells were randomly divided into 5 groups: (1) Normal; (2) Model + NC-siRNA; (3) Model + Sirt3-siRNA; (4) AS-IV + Sirt3-siRNA; (5) AS-IV.
6
Silencing Cx32 Expression in HK-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cx32-siRNA (:5′-CCGGCATTCTACTGCCATT-3′;
5′-GAAGAGGUAUUGAAUGCUA-3′) duplexes targeting Cx32 human gene (NCBI Gene ID: 2705) were used to silence the expression of Cx32. A nonspecific siRNA was used as control group (NC group). As for the overexpression and knockdown of miR-155-3p, the mimics、inhibitor and their negative controls were obtained from RiboBio. Transfection into HK-2 cells were carried out by using transfection kit (Ribobio, China), according to the manufacturer’s protocols. For Cx32-OP, HK-2 cells were plated at high density (125,000 cells/cm2) in 6-well plates. A total of 4 μg Plasmid-Cx32 was mixed with Lipo8 000™ transfection reagent to add to the medium. After 48 h, expression of Cx32 was detected by western blot analysis. HK-2 cells were transfected with 4 μg empty vector served as the control group.
5′-GAAGAGGUAUUGAAUGCUA-3′) duplexes targeting Cx32 human gene (NCBI Gene ID: 2705) were used to silence the expression of Cx32. A nonspecific siRNA was used as control group (NC group). As for the overexpression and knockdown of miR-155-3p, the mimics、inhibitor and their negative controls were obtained from RiboBio. Transfection into HK-2 cells were carried out by using transfection kit (Ribobio, China), according to the manufacturer’s protocols. For Cx32-OP, HK-2 cells were plated at high density (125,000 cells/cm2) in 6-well plates. A total of 4 μg Plasmid-Cx32 was mixed with Lipo8 000™ transfection reagent to add to the medium. After 48 h, expression of Cx32 was detected by western blot analysis. HK-2 cells were transfected with 4 μg empty vector served as the control group.
7
Knockdown of Acid Sphingomyelinase by siRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the knockdown experiments, specific siRNA oligonucleotides and control siRNA were purchased from RiboBio. The siRNA molecules were transfected into the cells using transfection kit (RiboBio) following the manufacturer's instructions. The sequences were listed below: aSMase siRNA‐1: 5'‐CCAGUGCAACUACCUACAUdTdT‐3' (sense); aSMase siRNA‐2: 5'‐GCCUCAUCUCUCUCAAUAUdTdT‐3' (sense); and aSMase siRNA‐3: 5'‐GUCUAUUCACCGCCAUCAAdTdT‐3' (sense). We detected the transfection efficiency by flow cytometry (Supplemental Figure S2 ).
8
Knockdown and Overexpression of DDX11-AS1 and HNRNPC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti-sense oligonucleotide (ASO) that specifically target DDX11-AS1 knockdown and siRNA that specifically targets HNRNPC knockdown were purchased from RiboBio (Guangzhou, China). According to the instructions, ASO and siRNA transfection were also performed using the transfection kit from RiboBio (Guangzhou, China). The ASO targeting sequence is as follows: GGAGAATGAATTCATGCTAA; si-HNRNPC-1: CTCGAAACGTCAGCGTGTA; si-HNRNPC-2: GCCTTCGTTCAGTATGTTA; si-HNRNPC-3: GTGAAGAAAGATGAGACTA. ASO and siRNA were transfected at 50 nM. The HNRNPC knockdown lentivirus was purchased from Genepharma (Shanghai, China), and its sequence was GCGCTTGTCTAAGATCAAATT.
To construct the cell model of DDX11-AS1 overexpression, DDX11-AS1 overexpressed lentivirus was purchased from GeneChem (Shanghai, China). The DDX11-AS1 lentiviral vector was GV502. According to the instructions, 48 h after the virus concentration gradient infected the cells, the infection efficiency was observed with a fluorescence microscope. When a multiplicity of infection (MOI) was 5 with 5 ug/mL Polybrene, the efficiency of infection can reach 80%.
To construct the cell model of DDX11-AS1 overexpression, DDX11-AS1 overexpressed lentivirus was purchased from GeneChem (Shanghai, China). The DDX11-AS1 lentiviral vector was GV502. According to the instructions, 48 h after the virus concentration gradient infected the cells, the infection efficiency was observed with a fluorescence microscope. When a multiplicity of infection (MOI) was 5 with 5 ug/mL Polybrene, the efficiency of infection can reach 80%.
9
Prostate Cancer Cell Lines Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCa (PC3, DU145, LNCaP, 22RV1) and normal control cells (WPMY-1) were purchased from Zhong Qiao Xin Zhou Biotechnology (Shanghai, China). PC3 and DU145 cells were cultured in F-12K medium, LNCaP and 22RV1 cells in 1640 medium, and WPMY1 cells in DMEM medium. Complete medium was obtained by adding 10% fetal bovine serum (FBS, ScienCell, USA) and 1% penicillin and streptomycin. The cell incubator was set at 37°C and 5% CO. The small interfering RNAs (si-RNAs) for cell transfection and the transfection kit were purchased from RiboBio company (Guangzhou, China). The transfection procedure was conducted according to the manufacturer’s instructions.
10
Downregulation of Cx43 in HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cx43 small interfering ribonucleic acid (siRNA) targeting the human gene (CAGUCUGCCUUUCGUUGUA) and nonspecific control siRNA (siNC) were transfected into HUVECs in the experiments. SiRNA transfection was carried out using a transfection kit (RIBOBIO, Guangzhou, CN), and the transfection efficiency was measured with Western blotting.
Detailed methods of electrophoretic mobility shift assay (EMSA) are shown inAppendix 1 .
Detailed methods of electrophoretic mobility shift assay (EMSA) are shown in
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!