The largest database of trusted experimental protocols

19 protocols using lv shnc

1

Overexpression and Silencing of EIF3D and GRP78

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant plasmids pcDNA3-EIF3D and pcDNA3-GRP78 were constructed to overexpress EIF3D and GRP78 in our laboratory, respectively. Recombinant lentiviruses targeting EIF3D (Lv-shEIF3D), GRP78 (Lv-shGRP78) or the scrambled nontargeting vector (Lv-shNC) was obtained from GeneChem Co., Ltd (Shanghai, China). Transfection of cells was carried out by exposing them to dilutions of the viral supernatant in the presence of polybrene (1 μg/mL) for 48  h, and the silencing efficiency of EIF3D or GRP78 was detected by Western blotting. The sequence of shEIF3D was: 5′ -GCGTCATTGACATCTGCATGACTCGAGTCATGCAGATGTCAATGACGCTTTTTT-3′. The shGRP78 sequence was CCGGCTTGTTGGTGGCTCGACTCGACTCGAGTCGAGTCGAGCCACCAACAAGTTTTT. The sequence of the control shRNA (shNC) was 5′-TTCTCCGAA CGTGTCACGTCTCGAGACGTGA-3′.
+ Open protocol
+ Expand
2

Downregulation of SPOCK1 by shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
The short hairpin RNAs (shRNAs) [14 (link)] which listed in Additional file 1: Table S1 were used to target SPOCK1. The sequence of the negative control shRNA was 5′-TTCTCCGAACGTGTCACGT-3′. shSPOCK1-1 and negative control shRNA were synthesized and inserted into the pFH1UGW lentivirus core vector containing a cytomegalovirus-driven enhanced green fluorescent protein (EGFP) reporter gene. Expression of the shRNA was driven by the H1 promoter. Recombinant lentiviruses expressing SPOCK1-shRNA or negative control shRNA (Lv-shSPOCK1 and Lv-shNC, respectively) were produced by Genechem (Shanghai, China). GBC-SD and NOZ cells were infected with concentrated virus in serum-free medium. The supernatant was replaced with complete culture medium after 24 h. SPOCK1 expression in the infected cells was validated by qRT-PCR analysis and western blot assays after 120 h.
+ Open protocol
+ Expand
3

Overexpression and Knockdown of CR-1 Using Lentiviral Vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols
To overexpress CR-1, the lentiviral vector encoding human CR-1 cDNA (LV-CR-1) was constructed by GeneChem (Shanghai, China). The empty vector was utilized as a negative control (LV-vector). To create CR-1 stable knockdown cells, the lentiviral containing CR-1 short hairpin RNA (LV-shCR-1) and the non-targeting negative control shRNA (LV-shNC) were obtained from GeneChem (Shanghai, China). The target for CR-1 were as follows: shRNA#1:5′-GCTAAATGGAAGGGCAAGTTT-3′; shRNA#2:5′-ACAGCACAGTAAGG AGCTAAA-3′; shRNA#3:5-CGCUUCUCUUACAGUGUGA-3′.In the current study, we utilized shCR-1#1 in the following experiments on the grounds that it could effectively downregulate endogenous CR-1 based on our preliminary experiments.
+ Open protocol
+ Expand
4

Overexpression and Knockdown of NETO2 in Pancreatic Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Full-length NETO2 cDNA (GenBank accession number NM_001201477.1) was subcloned into an expression vector (pcDNA3.1/+) using the primer sequences 5’-AGCTGCTCCACGTCAAAGAA-3’ and 5’-GCTCCC-GAGAGCTCGAA-3’. Then, a NETO2 overexpression plasmid and control vector (ie an empty pcDNA3.1/+ plasmid) was transfected into MIA PaCa-2 and PATU 8988 cells. The NETO2 expression level was examined by western blot.
The sequences of the siRNA specifically targeting NETO2 and its negative control (NC) were 5′-GCAGGAGUAUUUGAACAAA-3′ and 5ʹ-TTCTC-CGAACGTGTCACGT-3ʹ, respectively. A lentivirus-NETO2-shRNA (lv-shNETO2) that expressed NETO2-siRNA and a lentivirus-NC-shRNA (lv-shNC) that expressed NC-siRNA were purchased from Genechem (Shanghai, China). These lentiviruses—which contained puromycin resistance and a green-fluorescent protein reporter gene—were then stably transfected into PANC-1 and Capan-1 cells over 48 hrs at a multiplicity of infection of 50. These transfected cells were selected by puromycin (2 μg/mL) for 3 days and were used in subsequent experiments.
+ Open protocol
+ Expand
5

Subcutaneous Xenograft Model of NCI-H1299 Cells in BALB/C Nude Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
Five-week-old male BALB/C nude mice were purchased from the Vital River Laboratory (Beijing, China) in this vivo experiment, which was approved by the Animal Ethics Committee of the People’s Hospital of Shouguang. Whereafter, a total of 5×106 NCI-H1299 cells stably transfected with LV-sh-NC or LV-sh-JPX (Genechem) were injected subcutaneously into the flank of the nude mice with 6 mice in each group, and the tumor volume every 5 days. A month later, all mice were sacrificed, and the resected tumor masses were harvested for weighting and further analysis.
+ Open protocol
+ Expand
6

FOXK1 Expression Modulation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The full-length FOXK1 cDNA (GenBank accession number NM_001037165) was amplified and subcloned to into pCDNA3.1 expressing vector (Invitrogen, Carlsbad, CA). The expression level of FOXK1 was then examined by western blot. Empty vector- transfected cells were used as a control.
Small interfering RNA (siRNA) targeting FOXK1 and negative control was specifically synthesized by GenePharma (Shanghai, China). Lipofectamine RNAiMAX (Thermo Fisher Scientific, Waltham, MA) was used to transfect siRNAs into cells according to the manufacturer's protocol. The siRNA sequences were as follows: siFOXK1 sense strand, 5′-GCAUGGGCCUGUCCAGCUUT−3′; the scrambled (src) siRNA 5′-TTCTCCGAACGTGTCACGT-3. The siRNA-transfected cells were harvested in the medium for 2 days after transfection and then used for subsequent studies.
Lentiviral vectors containing human FOXK1 short-hairpin RNA (Lv-shFOXK1) and scrambled non-targeting shRNA (Lv-shNC) which was served as negative control were provided by Genechem Company (Shanghai, China). The guiding strand sequences of Lv-shRNA were as follows: shFOXK1, 5′- CCTCTCTCTTAACCGCTACTT-3′; shNC, 5′- TTCTCCGAACGTGTCACGT-3′; Cells were infected with indicated lentivirus at an multiplicity of infection (MOI) of 20 for 48 h and then selected with puromycin (1.5 μg/mL) for 7 days. The expression level of FOXK1 in the infected cells was validated by western blot analysis.
+ Open protocol
+ Expand
7

Investigating SIRT3 Knockdown and PA-Induced Effects in MNK3 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MNK3 cells were cultured in a cell medium composed of DMEM, 10% FBS, and penicillin/streptomycin. For the construction of the SIRT3 knockdown cell line, MNK3 cells were co-cultured with SIRT3 knockdown lentivirus (LV-shSIRT3) or blank vector (LV-shNC) (Shanghai Genechem Co., Ltd, Shanghai, China.) for 12 h, and then the culture medium was replaced. The lentivirus-infected cells were screened in a culture medium containing puromycin for purification. To detect the effect of DHM and palmitic acid (PA) on MNK3 cells, cells were pretreated with DHM for 4 h followed by PA (0.2 mM) for another 12 h. To detect the involvement of AMPK, SIRT3, or STAT3 in DHM-induced benefits on MNK3 cells, cells were pretreated with inhibitors of SIRT3 (3-TYP, 50 μM; MCE, Newark, USA), AMPK (Dorsomorphin, 10 μM; MCE) or STAT3 (Static, 5 μM; Selleck Chemicals, TX, USA) for 2 h prior to the treatment of DHM and PA.
+ Open protocol
+ Expand
8

Modulating circular RNA in cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Small interference RNA against circ_0005962 and negative control were synthesized by Sangon Biotech (Shanghai, China). The mimics of miR-382-5p (miR-382-5p), the inhibitor of miR-382-5p (anti-miR-382-5p), and respective negative control (NC or anti-NC) were purchased from Ribobio (Shanghai, China). The overexpression of circ_0005962 (circ_0005962) was performed as the previous study described [24 (link)] and constructed by Genechem (Shanghai, China), while the specific plasmid without the circ_0005962 cDNA was served as a control (circ-NC). The vector pcDNA3.1-PDK4 for the overexpression of PDK4 and the control pcDNA empty vector (vector) were constructed by Sangon Biotech. Lentiviral vector (Lenti-short hairpin) for stable NEAT1 downregulation (Lv-sh-circ_0005962) and the corresponding negative control (Lv-sh-NC) were obtained from Genechem. Cell transfection was conducted using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). Transfection efficiency and the following experiments were implemented after 48 h of transfection.
+ Open protocol
+ Expand
9

Lentivirus-mediated Rgs4 Modulation in Myocardial Infarction

Check if the same lab product or an alternative is used in the 5 most similar protocols
The lentivirus-mediated shRNA for Rgs4 (LV-shRGS4) (5′ CACC GGGA GGTT CACA TCCT AAAC GAAT TTAG GATG TGAA CCTCCC3′) and the lentivirus carrying scrambled shRNA (LV-shNC) (5′GTTC TCCG AACG TGTC ACGT3′) as negative control were synthesized by Genechem (Shanghai, China). The lentivirus-mediated Rgs4 (LV-RGS4) was used to overexpress Rgs4. Briefly, mice were anaesthetized, a thoracotomy was performed through the fourth intercostal space. The ascending aortic artery and the main pulmonary artery were clamped. The lentivirus was injected (2.5 × 107 TU·mL−1 at a volume of 100 μL) through the tip of the heart into the left ventricular cavity. The arteries were occluded for 10 s after lentivirus injection [21 (link)]. Myocardial infarction operation was started 7 days after lentivirus injection. The treatment process of mice was shown in Table 1.

The treatment process of mice

0 day7 day10 day35 day
Part I

Lentivirus injection

(LV-shRGS4/NC)

MI surgeryCollected heart tissue
Part II

Lentivirus injection

(LV-RGS4/NC)

MI surgeryCholine treatmentCollected heart tissue
+ Open protocol
+ Expand
10

Silencing SOST and FTO in BMSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Three siRNAs targeting sclerostin (SOST, Gene ID: 74499) (siSOST) and negative control RNAs (siNC) were synthesized by Sangon (Shanghai, China). At 16–18 h of seeding, the BMSCs approximately at 80% confluence were transient transfected with siRNAs by Lipofectamine3000 (L3000015, Invitrogen, CA, USA) according to the manufacturer’s protocols.
The LV-Fto-RNAi (LV-shFTO) and LV-negative control (LV-shNC) were constructed by Genechem (Shanghai, China). BMSCs reached 30% confluent were infected with lentivirals by HitransG with MOL 10 according to the manufacturer’s instructions.
MC3T3 cells were chosen to establish stable FTO knockdown models, that were infected with LV-shFTO (Mol = 5) and were selected using puromycin (2 μg/ml). Real-Time quantitative Polymerase Chain Reaction (RT-qPCR) and Western blot (WB) were used to identify the efficiency of FTO knockdown. The primer sequences for PCR are provided in Additional file 1. The targeted sequences for siRNAs and shFTO are listed in Additional file 2.
Full details of the materials and methods are provided in Additional file 3.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!