Streptavidin mutein matrix

After reaching >80% confluence, the cells were treated with 500 μL mixture containing 25 mM Tris-HCl, 70 mM KCl, 0.05% NP-40, 80 U/mL RNase inhibitor, and 2.5 mM EDTA. After centrifuging at 12,000 x g for 15 min, biotin-labeled miR-361-3p mimic (bio-mimic) or mimic-NC (bio-NC) from RiboBio (China) was added to the supernatant and incubated for 30 min. Then, 10 μL Streptavidin Mutein Matrix (Roche Applied Science) was added to the supernatant and incubated for 3 h. Finally, the mixture was collected and washed five times to obtain the biotin-miRNA/mRNA complex. RT-qPCR was used to detect bound RNA expression [39 (link)].

Purification of Avi‐mGCPII was performed as previously described 34. Briefly, cell medium (1000 mL) containing secreted biotinylated Avi‐mGCPII was centrifuged at 3400 g for 45 min. Then, it was concentrated 10‐fold using a LabScale TFF System (Merck Millipore, Billerica, MA, USA) with a Pellicon^® XL 50 Cassette, Biomax 100. The concentrated medium was centrifuged again at 3400 g for 20 min and equilibrated with 300 mm Tris/HCl, 450 mm NaCl, pH 7.2 in a 2 : 1 ratio. The equilibrated concentrated Avi‐mGCPII medium was then mixed with 1 mL Streptavidin Mutein Matrix (Roche, Basel, Switzerland) and incubated with gentle shaking at 6 °C for 15 h. Afterward, the resin was washed with 50 column volumes of 100 mm Tris/HCl, 150 mm NaCl, pH 7.2. Bound biotinylated proteins were eluted with 5 mL of 100 mm Tris/HCl, 150 mm NaCl, 2 mm D‐biotin, pH 7.2, in five consecutive elution fractions (after the first elution fraction, the resin was incubated with elution buffer for 1 h). After regeneration of the resin, the flow‐through fraction was again mixed with the resin, and the purification procedure was repeated.

The pull‐down assay of target mRNAs of miR‐20a‐5p was performed as described previously.16 Briefly, semiconfluent BMM and MDA‐MB‐231 cells on 90‐mm culture dishes were harvested and treated with 0.5 mL of lysis buffer, followed by the incubation with biotinylated double‐stranded RNA (8 nmoles) of miR‐20a‐5p. Furthermore, the extract was incubated with Streptavidin Mutein Matrix (Roche). The Streptavidin/biotin–miRNA/mRNA complex was collected and the relative enrichment of SRCIN1 was assessed by RT‐PCR using the following primers: mmu‐SRCIN1, F: AGCAGGACAGGATGCGAGAACA, R: TGATGAGGATGGCGGTGTTGG; has‐SRCIN1, F: GAACGGCTGCGCTATCTCAA, R: GGATCTTCTCCACCGATTTCTCC.

The gene fragment encoding rStx2aB was amplified by PCR and recloned in an expression vector (Amp^R) to incorporate the human IgA1 hinge and the biotin acceptor domain (BAD) at the C-terminus of the expressed rStx2aB protein [47 (link)]. The ligated vector was co-transformed with BirA plasmid (Chloramphenicol^R), encoding biotin protein ligase, in electrocompetent E. coli WK6 cells [47 (link)]. To produce biotinylated rStx2aB, 1 mL of an overnight starter culture was inoculated in 330 mL terrific broth (TB) supplemented with ampicillin (100 μg/mL) and chloramphenicol (35 μg/mL). Cells were grown at 37 °C, while shaking, until an O.D._600nm of 0.6 was reached, then 0.02 mM D-biotin was added to the cultures and 30 min later, the expression of the recombinant rStx2aB-BAD protein was induced with 0.2 mM IPTG and overnight incubation at 28 °C. The next morning, cells were harvested by centrifugation. The biotinylated rStx2aB from the bacterial lysate was purified by affinity chromatography on streptavidin mutein matrix (Roche, Basel, Switzerland), followed by size exclusion chromatography on FPLC system (ÄKTA, GE Healthcare) [48 (link)]. Protein production was analyzed by SDS-PAGE under reducing conditions using 12% Bis-Tris gel (Bio-Rad) and Western blot.

The extracellular part of human wild-type recombinant PSMA (wtPSMA; amino acids 44–750) comprising an N-terminal Strep-FLAG tag, as well as its S317A and S317H mutants, were produced as described previously (25 (link)). Briefly, the recombinant protein was secreted into the culture medium by stably transfected Schneider's S2 cells. The medium was concentrated by tangential flow filtration (TFF, Millipore, Molsheim, France), dialyzed against the purification buffer (50 mM Tris–HCl, 150 mM NaCl, pH 8.0) and purified by Strep-Tactin affinity chromatography (Strep-Tactin Superflow, IBA, Germany) followed by size exclusion chromatography on a Superdex HR200 column (GE Healthcare, Chicago, IL, USA) in TBS buffer (50 mM Tris–HCl, 150 mM NaCl, pH 7.4).
N-terminally-tagged (Avi-tag biotinylated in-vivo) murine PSMA (mPSMA) and human GCPIII were recombinantly expressed from Drosophila S2 cells and affinity purified using the Streptavidin Mutein Matrix (Roche, Basel, Switzerland). Detailed protocols for cloning, expression and affinity purification of the PSMA paralogs/orthologs are described elsewhere (48 ,49 ). The final size-exclusion chromatography step was identical as described above for human PSMA.

The expression and purification of the extracellular domain of human PSMA (residues 44–750) that comprised an N-terminal Avi-tag (Avi-PSMA) run according to protocol published earlier [54 (link),84 (link)]. Briefly, the recombinant protein was expressed by stably transfected Schneider S2 cells and purified by the combination of affinity chromatography (Streptavidin Mutein Matrix, Roche) and size-exclusion chromatography on a Superdex 200 column (GE Healthcare Bio-Sciences). Concentrated PSMA stock was stored at −80 °C until further use.

We subcloned the VHH gene fragment to a pBAD vector after digestion by NcoI and BstEII restriction endonucleases and co-transformed the ligated material into WK6 cells with pBirA plasmid [19 (link)]. The expression of VHH-BAD fusion protein was induced with 1 mM IPTG followed by the addition of 50 μM d-biotin (Bio Basic Inc., Beijing, China) and incubated for 30 min. Cells were collected and the periplasmic proteins extracted by osmotic shock. Soluble nanobodies, which were coupled to biotin, were purified by Streptavidin Mutein Matrix (Roche, Basel, Germany). After washing with PBS, the nanobodies conjugated with biotin were eluted by 6 mM d-biotin and dialyzed into PBS.