Qiashredder homogenizer
The QIAshredder homogenizer is a laboratory instrument designed to disrupt and homogenize biological samples, such as cells or tissues, in preparation for subsequent processing or analysis.
Lab products found in correlation
48 protocols using qiashredder homogenizer
Hippocampal Neuron SAP97 Regulation
Evaluating GITR Expression in Visceral Leishmaniasis
Quantitative PCR Analysis of Cartilage
VEGF | Forward | CCCACGTCAGAGAGCAACA | 101 |
Reverse | TCACATCTGCTGTGCTGTAGG | ||
Col10 | Forward | AGGCAAGCCAGGCTATGGAA | 83 |
Reverse | GCTTCCCCGTGGCTGATATTC | ||
MMP13 | Forward | GCTGCGGTTCACTTTGAGAA | 106 |
Reverse | GGCGGGGATAATCTTTGTCCA |
Quantitative Real-Time PCR Protocol
Horse Peripheral Blood Proteome Analysis
qRT-PCR Gene Expression Analysis
Quantification of DHRS9 and IDO1 mRNA
Real-Time PCR Cortical Cell RNA Extraction
DMSO and PLX4720 Treatment Quantification
Quantitative real-time PCR protocol for gene expression analysis
To analyze the mRNA expression of SP-A, we have compared the data from the infection with the pathogens and the data of the stimulation with recombinant TNF-α. For this, we used 10 nM of TNF-α (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) added to RPMI. After 30 min of incubation on NCI-H441 cells, they were washed with PBS and incubated for 4 h. Afterward, the mRNA expression was performed as described above.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!