Lc480 fluorescent quantitative pcr instrument

Manufactured by Roche

Sourced in United States

The LC480 is a real-time quantitative PCR (qPCR) instrument designed for automated nucleic acid quantification. It utilizes fluorescence detection to measure the amplification of target DNA or RNA sequences in real-time during the PCR reaction. The core function of the LC480 is to perform precise and reliable quantitative analysis of nucleic acid samples.

Automatically generated - may contain errors

Lab products found in correlation

Riboscript reverse transcription kit, by RiboBio (2 mentions) Iqtm sybr green supermix, by Bio-Rad (1 mentions) Mirna qpcr starter kit, by RiboBio (1 mentions)

Spelling variants of this product

LC480 (158 citations) LC480 instrument (30 citations)

2 protocols using lc480 fluorescent quantitative pcr instrument

Profiling Circulating CircRNAs in COPD

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT-qPCR was performed on the RNA obtained from blood samples of the remaining 27 patients with COPD and 27 healthy controls, and the expression of related circRNAs was also verified in 15 patients with non-very severe COPD. The qRT-PCR method was as follows: according to the kit instructions, RNA was reverse-transcribed into cDNA using the riboSCRIPT Reverse Transcription Kit (C11027, RiboBio, Guangzhou, China), and qRT-PCR was performed using iQTM SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA) with an LC480 fluorescent quantitative PCR instrument (Roche, Basel, Switzerland). The reaction conditions were as follows: 95 ℃ for 10 min, followed by 45 cycles of 95 ℃ for 10 s, 60 ℃ for 25 s, and 70 ℃ for 25 s. λ polyA (No.3789, TakaRa, Tokyo, Japan) was used as the external reference, and three complex wells were set up for each circRNA. The primer sequences used for circRNA analysis are shown in Table 1. The qRT-PCR results were analyzed by relative quantification using the 2^−ΔΔCt method.

Table 1

Primer sequences used for RT-qPCR

CircRNA	Forward primer (5′–3′)	Reverse primer (5′–3′)
hsa_circ_0008882	GGAATACCTTTCCTCACAGGAC	CTAGGCTGCCAATGGTGAG
hsa_circ_0089763	TTTAGTTGGGGCATTTATGTGA	CCTCAACCCAAAAAGGCATA
hsa_circ_0062683	GTCTCCCTGTCCAAGGCTCT	CCTTGGGCACTCTCATCTCT
hsa_circ_0077607	CTGCCCTTCACTTTGACCAG	GCTCCCAACTAGAAAGTATCTCTTCA

Tang S., Ding Y., Zhou Z, & Yang W. (2023). Identification and bioinformatic analysis of CircRNAs in the plasma of patients with very severe chronic obstructive pulmonary disease. BMC Pulmonary Medicine, 23, 211.

+ Open protocol

+ Expand

Plasma miR-150-5p Quantification in COPD

Check if the same lab product or an alternative is used in the 5 most similar protocols

Five milliliters of fasting peripheral blood was collected in an EDTA-K2 purple anticoagulant tube in the morning from healthy controls and before each COPD patient was admitted to the hospital for treatment, then centrifuged at 4 °C at 3000 r/min for 15 min. After centrifugation, the upper plasma layer was transferred to a sterilized Eppendorf tube and stored at −80 °C. The qRT-PCR protocol was as follows: RNA extraction using an miRcute Plasma miRNA Isolation Kit (DP503, Tiangen Biotech, Beijing, China), reverse transcription using a riboSCRIPT Reverse Transcription Kit (C11027, RiboBio, Guangzhou, China), and finally qRT-PCR using an miRNA qPCR Starter Kit (C10211, RiboBio) with amplification in a LC480 fluorescent quantitative PCR instrument (Roche, Basel, Switzerland). The reaction conditions were 95 °C for 10 min, followed by 45 cycles of 95 °C for 10s, 60 °C for 25s, and 70 °C for 25s. The primers (RiboBio) were designed and synthesized using the stem-loop method. The miR-150-5p sequence is 5′-UCUCCCAACCCUUGUACCAGUG-3′. Cel-miR-39-3p was used as the internal reference gene. qRT-PCR analyses were repeated 3 times and averaged. Relative results were calculated using the 2^−ΔΔCt method.

Ding Y., Tang S., Zhou Z., Wei H, & Yang W. (2023). Plasma miR-150-5p as a Biomarker for Chronic Obstructive Pulmonary Disease. International Journal of Chronic Obstructive Pulmonary Disease, 18, 399-406.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!