Total RNA from mouse testis tissues was extracted using TRIpure Reagent Total RNA Extraction Reagent (Beijing Adler Biotechnology Co., Ltd., China) as per the manufacturer’s instructions. RT-qPCR was performed for expression level analysis using the 5× HiScript II Select qRT SuperMix II and AceQ qPCR SYBR Green Master Mix (Vazyme, China) with the 7300 Real-Time PCR System (Applied Biosystems, USA). The data were normalized to β-actin expression and then further normalized to the negative control unless otherwise indicated. Custom primers for C/EBP-α, PPAR-γ, tumour necrosis factor α (TNF-α), and monocyte chemoattractant protein-1 (MCP-1) were synthesized as follows: β-actin forward primer 5'-ACTCATCGTACTCCTGCTTGCTGA-3' and reverse primer 5'-AGGGAAATCGTGGGTGACATCAAA-3'; C/EBP-α forward primer 5'-CCTTCAACGACGAGTTCCTG-3' and reverse primer 5'-TGGCCTTCTCCTGCTGTC-3'; PPAR-γ forward primer 5'-CTGGCCTCCCTGATGAATAA-3' and reverse primer 5'-GGCGGTCTCCACTGAGAATA-3'; TNF-α forward primer 5'-CAGATTGACCTCAGCGCTGAGTTG-3' and reverse primer 5'-ACCCTCACACTCAGATCATCTTCT-3'; MCP-1 forward primer 5'-GGGATCATCTTGCTGGTGAA-3' and reverse primer 5'-AGGTCCCTGTCATGCTTCTG-3'. The three-step method was used. Data were analyzed using the 2−ΔΔCt method.
Hiscript 2 select qrt supermix 2
Manufactured by Vazyme
Sourced in China
The 5× HiScript II Select qRT SuperMix II is a laboratory reagent designed for reverse transcription and real-time quantitative PCR (RT-qPCR) applications. It contains a high-efficiency reverse transcriptase and a specially formulated PCR master mix optimized for sensitive and accurate gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Aceq qpcr sybr green master mix, by Vazyme (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Rnaiso plus, by Takara Bio (3 mentions)
Sybr green master mix, by Vazyme (2 mentions)
7300 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Gdna wiper mix, by Vazyme (1 mentions)
Tripure reagent kit, by Aidlab (1 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (1 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
Hipure plant rna mini kit, by Magen Biotechnology Co (1 mentions)
Hiscript 2 q select rt supermix for qpcr, by Vazyme (1 mentions)
Biodrop duo, by Harvard Bioscience (1 mentions)
9 protocols using hiscript 2 select qrt supermix 2
1
Mouse Testis RNA Extraction and qRT-PCR Analysis
2
Isolation and Quantification of Cardiac Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of roughly 100 mg of fresh tissue was taken, frozen, and kept at -80°C. Total RNA was isolated from the obtained cardiac tissue using Trizol reagent (#15596-026, Ambion, California, USA) and kept at -80°C in the refrigerator as a backup. First-strand cDNA was synthesized from total RNA using 4× gDNA wiper mix (#R223-01, VAZYME, Nanjing, China). 5× HiScript II Select qRT SuperMix II (#R233-01, VAZYME, Nanjing, China) was used to detect amplification of specific PCR products according to the manufacturer's instructions. It was done by electrophoresis with GelRed and DNA markers in GelRed, which resulted in separation of PCR products from each other. As a control, GAPDH was employed. The manufacturer's instructions were followed for doing real-time quantitative PCR using SYBR Green Master Mix (#R223-01, VAZYME, Nanjing, China). Data were normalized based on β-actin mRNA levels. The final specific primer sequences (SANGON, Shanghai, China) are listed in Table 1 below.
3
Quantitative RT-PCR Analysis of GAPDH and MRP1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s instructions, the total RNA was isolated from A549 and H1299 cells using a TRIpure reagent kit (Aidlab Biotechnologies, Beijing, China). The RNA (500 μg) was reversibly transcribed with 4 μl 4× gDNA wiper Mix, 1 μl Oligo (dT) 18 (10 μM) primer, and 4 μl 5×HiScript® II Select qRTSuperMix II (Vazyme Biotech, Nanjing, China). Then we used the 2×AceQ qPCR SYBR Green Master Mix (Vazyme Biotech, Nanjing, China) and specific primers to perform PCR amplification. The following forward and reverse primers (5′-3′) were used: GAPDH forward, AGA TCC CTC CAA AAT CAA GTG G; and GAPDH reverse, GGC AGA GAT GAT GAC CCT TTT; MRP1 forward, TCT CAA CAA AAC CAA AAC TGC CT; and MRP1 reverse, CTG AAC TCC CTT CCT CCT CTC C. Observing the specificity of the melting curve after the reaction and calculating the 2−ΔΔCt according to the formula. The experiment was repeated three times.
4
PBMC RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood mononuclear cells (PBMCs) were isolated from the blood sample of each patient. Total RNA from PBMCs was extracted using TRIzol reagent (Ambion; Thermo Fisher Scientific, Waltham, MA, USA) following standard procedures. An optical density ratio at 260 nm/208 nm of 1.8–2.0 satisfied the experimental requirements. RNA (2 µg) from each sample was reverse-transcribed into cDNA using 5× HiScript II Select qRT SuperMix II (VAZYME, Nanjing, China). qPCR was performed with SYBR Green Master Mix (VAZYME) using an ABI QuantStudio 6 Real-Time System (Applied Biosystems, Waltham, MA, USA), according to the standard protocols, programmed to perform 42 cycles in total. Specific primers for mRNAs were synthesized by Tsingke Biotechnology (Beijing, China). Relative mRNA transcript levels were normalized to those of β-actin. The primer sequences are as follows: CTNNB1 forward CCAAGTGGGTGGTATAGAGG, reverse AGTCCATAGTGAAGGCGAAC (156 bp); MITF forward CCAAAGAGAGGCAGAAAAAGGA, reverse CGTGGATGGAATAAGGGAAAGTC (311 bp); TNFSF11 forward ATCTGGTTCCCATAAAGTGAG, reverse CGAAAGCAAATGTTGGCATA (141 bp); and β-actin forward CCCTGGAGAAGAGCTACGAG, reverse CGTACAGGTCTTTGCGGATG (180 bp). The expression level of each mRNA was calculated using the 2−△△Ct method.
5
Comprehensive RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRIzol Reagent (Ambion, Life Technologies, New York, USA), chloroform, isopropanol, and ethanol were used to extract the total RNA. RNase-free water was used to dissolve total RNA from GCs. Oligo (dT)23VN (10 μM), 4× gDNA wiper Mix, and RNase-free ddH2O at 42°C were used for 2 min to remove the DNA from the GCs. We used the 5× HiScript II Select qRT SuperMix II at 50°C for 15 min to convert the RNA into cDNA (Vazyme, R223-01, China) (26 (link)). Prior to quantitative RT-PCR (qRT-PCR) amplification, the sequences of primers for BAX, BCL2, CASPASE3, CYP19A1, VEGFA, and GAPDH (Table 1 ) were designed using the Oligo 7.0 software. qRT-PCR was performed on an Applied Biosystems 7500 Real-Time PCR System (ABI7500; Applied Biosystems, Carlsbad, CA, USA) using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711-02/03, China) following the manufacturer's instructions. The relative expression of each gene was calculated using the 2−ΔΔCt method with GAPDH as the reference gene.
6
SH-SY5Y Cells RNA Isolation and qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from SH‐SY5Y cells was isolated by using RNAiso plus (Takara). cDNA was reverse transcribed using 5×HiScript II Select qRT Super Mix II (Vazyme, China) according to the manufacturer's instructions. Primers were synthesized by Sangon Biotech (Shanghai, China) and were listed in Supplemental Materials. The relative expression level of RNA was measured by qPCR system of AceQ qPCR SYBR Green Master Mix (Vazyme, China).
7
Quantifying ADAM10 mRNA Expression in SH-SY5Y and HEK293 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from SHY5Y or HEK293 cells was extracted using RNAiso plus (Takara, Dalian, Liaoning, China) according to manufacturer’s instructions. cDNA was synthesized from 500 ng total RNA using 5× HiScript II Select qRT Super Mix II (R233-01-AC, Vazyme, Nanjing, China) according to manufacturer’s guidelines. PCR reactions were performed with AceQ qPCR SYBR Green Master Mix (Q111-02, Vazyme, Nanjing, China). The reaction mixture consisted of 0.4 μl of each primer, 4 μl diluted cDNA, 5.2 μl DNase/RNase-free water, and 10 μl 2× SYBR. The parameters were as follows: 95°C for 5 min, 40 cycles at 95°C for 10 s, and 60°C for 30 s. A melting curve was run after each RT-PCR. The Ct value of each sample was calculated, and the relative mRNA level of ADAM10 was normalized relative to that of GAPDH. Fold changes were quantified using the 2−ΔΔCt method. ADAM10 primer sequences (NM_001110) were 5’-TTATGTGCCCCGTGTTCCCTGTTCT-3’ (forward) and 5’-GGTCGAGCCTCCTAGCCTTGATTGG-3’ (reverse). GAPDH primer sequences (NM_001289746) were 5’-CAGGAGGCATTGCTGATGAT-3’ (forward) and 5’-GAAGGCTGGGGCTCATTT-3’ (reverse).
8
Quantitative RT-PCR Analysis of APP, BACE1, and ADAM10 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from SH-SY5Y cells using RNAiso plus (Takara, Dalian, Liaoning, China), and cDNA was generated by the 5 × HiScript II Select qRT Super Mix II (R233-01-AC, Vazyme, Nanjing, China) according to the manufacturer's instructions. All qRT-PCRs were run and analyzed on the CFX96 Touch Real-Time PCR Detection System (Bio-Rad). The reaction mixture (20 μl total) contained 10 μl SYBR mix, 5.2 μl nuclease-freewater, 0.4 μl of each primer, and 4 μl diluted cDNA. Reactions were performed using the following steps: 1 cycles of 95 °C for 5 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s, and the melting curve was run after RT-PCR. Total human APP, BACE1, ADAM10 mRNA levels were normalized to human glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA levels. The results presented are based on fold change using the 2ˆ-ΔΔCt method. The primer sequences were as follows: ADAM10: 5′-TTATGTGCCCCGTGTTCCCTGTTCT-3′ (forward) and 5′-GGTCGAGCCTCCTAGCCTTGATTGG-3′ (reverse); BACE1: 5′-GCAAGGAGTACAACTATGAC-3′ (forward) and 5′-AGCTTCAAACACTTTCTTGG-3’ (reverse); APP: 5′-TGGTGGGCGGTGTTGTCATA-3′ (forward) and 5′-TGGATTTTCGTAGCCGTTCTGC-3′ (reverse); GAPDH: 5′-AGAAGGCTGGGGCTCATTTG-3′ (forward) and 5′-TGCTGATGATCTTGAGGCTGTTG-3′ (reverse).
9
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh samples (two seeds) at 24 h and 72 h were grounded into powder, kept in an ice bath for 5 min after adding 1.5 ml TRE-Trizol and vortex mixed. For RNA extraction the HiPure Plant RNA Mini Kit (R4154-01, Magen, China) was used and the manufacturer’s protocols were followed. The quality of RNA was detected by an ultra-micro spectrophotometer (BioDrop Duo+, Biochrom Ltd, Germany). The cDNA was synthesized by HiScript II Q Select RT SuperMix for qPCR (+gDNA wiper) with 5 × HiScript® II Select qRT SuperMix II (R233-01, Vazyme, China) according to its protocol. The qRT-PCR analysis was conducted by qRT-PCR (CFX96, BIO-RAD, USA). Three replicates of each sample were set up with no cDNA template as a negative control, and actin was used as an internal reference gene. The PCR amplification rate was guaranteed to be between 95 % and 105 % and the relative gene expression was calculated using the method of Ct. The primer sequences of OGG1, PIMT1, MSRA2.1, and MSRA4 were listed (Table S1 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!