H1975

The human cancer cell lines A549, A431, H3255, H1975, PC-9, HCC827, H23, H460, A549, H358 and H2122 cells were purchased from the American Type Culture Collection (ATCC) (Manassas, VA, USA). H1975, PC-9, HCC827, H23, H460, H358, H2122 and EGFR mutant isogenic BaF3 cells lines were cultured in RPMI 1640 media (Corning, USA) with 10% fetal bovine serum (FBS) and supplemented with 2% L-glutamine and 1% penicillin/streptomycin. A549 and A431 were cultured in DMEM media (Corning, USA) with 10% FBS and supplemented with 2% L-glutamine and 1% pen/strep. H3255 was cultured in BEGM media (LONZA, USA) with 10% FBS and supplemented with 2% L-glutamine and 1% pen/strep.

Independent shRNAs targeting PAQR4 were constructed using a pLKO.1 vector. The two independent PAQR4 targeting sequences are: shRNA#1, 5'-GCAGGCTCCGTGCTCTATCAC-3'; shRNA#2, 5'-CGTCTTGCTCTGAGAGTTCAA-3'. The pNFE2L2 (NRF2)-ENTER (Gene ID: NM_006164) and pKEAP1-ENTER (Gene ID: NM_203500) plasmids were purchased from Vigene Biosciences Inc., and were sub-cloned into pCDNA3.1. Nrf2 was N-terminal tagged with 6×Myc, and Keap1 was N-terminal tagged with 3×HA. The full length cDNA of PAQR4 (Gene ID: NM_152341.5) was synthesized by Shanghai Generay Biotech, and sub-cloned into pCDH-MSCV-E2F-eGFP lentiviral vector or pCDNA3.1 vector with a 3×Flag at the C-terminus. The lentiviruses were generated according to the manufacturer's protocol, stable cell lines were generated by lenti-viral infection. The BEAS-2B cell line was a gift from Dr. Hongbin Ji at SIBS, CAS, China. HEK-293T was obtained from ATCC. A549, H1299, H1975, H1650 were purchased from Cobioer, China with STR document, BEAS-2B, A549, H1650, H1975, H358, GLC-82 and SPC-A1 cells were cultured in RPMI1640 medium (Corning) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. H1299 and HEK-293T cells were cultured in DMEM medium (Corning).

The BEAS-2B cell line was purchased from cell bank of Kunming Institute of Zoology, and cultured in BEGM media (Lonza, CC-3170). Lung cancer cell lines, including A549, H1650 and H1975 were purchased from Cobioer, China with STR document, A549, H1650 and H1975 cells were all cultured in RPMI1640 medium (Corning) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin.

Cell culture, RNA isolation, and real-time polymerase chain reaction (PCR) assay were performed as published (Shi et al., 2019 (link)). The BEAS-2B cell line was purchased from the cell bank of Kunming Institute of Zoology and cultured in BEGM media (Lonza, CC-3170). HEK-293T was obtained from ATCC. Lung cancer cell lines, including A549, H1299, and H1975, were purchased from Cobioer (China) with STR documents; A549, H1299, and H1975 cells were all cultured in RPMI 1640 medium (Corning) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. HEK-293T cells were cultured in a Dulbecco modified eagle medium (Corning). The detail information of primer used in this study are as follows: NCAPG-F: GAG​GCT​GCT​GTC​GAT​TAA​GGA, NCAPG-R: AAC​TGT​CTT​ATC​ATC​CAT​CGT​GC, TYMSOS-F: ATG​ACG​CCC​GCC​TCG​GGG​GCC, TYMSOS-R: TCA​GGA​AGG​ACG​ACC​GCA​CGG​GCA​CC, FOXM1-F: CGT​CGG​CCA​CTG​ATT​CTC​AAA, FOXM1-R: GGC​AGG​GGA​TCT​CTT​AGG​TTC, miRNA-214-3p-F TTT​TTA​CTA​CTA​TGG​CGG​GTG​ATA​AAA​CGT​GTA, miRNA-214-3p-R: GCA​AGC​TGT​AAT​CGA​CGG​GAA​GAG​CAT​GCC​CAT​CC, ACTIN-F: CTTCGCGGGCGACGAT, and ACTIN-R: CCA​TAG​GAA​TCC​TTC​TGA​CC. The expression quantification was obtained with the 2^−ΔΔCt method.

The human bronchial epithelial cell line (BEAS2B) and the LUAD cell lines were purchased from the Cell Bank of Kunming Institute of Zoology and cultured in bronchial epithelial cell growth medium (BEGM) (CC-3170; Lonza, Basel, Switzerland). The HEK-293T cell line was obtained from the American Type Culture Collection (ATCC). The lung cancer cell lines A549, H1299, and H1975 were purchased from Cobioer (Nanjing, China) with short tandem repeat (STR) document. A549, H1299, and H1975 cells were all cultured in RPMI 1640 medium (Corning, Corning, NY, USA) supplemented with 10% fetal bovine serum (cat. no. 10099141C; Gibco, Waltham, MA, USA) and 1% penicillin/streptomycin. HEK-293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Corning). The short hairpin RNA (shRNA) for HMMR was constructed using pLKO.1 vector. The shRNA for the HMMR primer sequences are as follows: HMMR shRNA#1: AAACAGCTGGAAGATGAAGAAGGAA; HMMR shRNA#2: CAGCTGGAAGATGAAGAAGGAAGAA.

NSCLC adenocarcinoma cell lines A549, H1975, H1755, H1944, H2087, and H358, and NSCLC large cell carcinoma cell lines H661 and H1299 were maintained in RPMI 1640 + l-glutamine (Corning, Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (FBS, Atlanta Biologicals), 5 mg/mL D-glucose (Sigma-Aldrich, St. Louis, MO, USA), 5 mM HEPES (Invitrogen, ThermoFisher Scientific, Waltham, MA, USA), and 0.05 mM sodium pyruvate (Sigma). HBE2 was maintained in Keratinocyte SFM without calcium chloride medium (Gibco, ThermoFisher Scientific, Waltham, MA, USA). Cells were maintained in a humidified environment at 37 °C and 5% CO₂. Cell lines A549, H1755, H1944, and H2087 were obtained from ATCC (Manassas, VA, USA). H1975, H661, H1299, H358, and HBE2 were a generous gift from Dr. Feng Jiang, University of Maryland School of Medicine. All used cell lines regularly tested negative for mycoplasma contamination throughout the whole duration of this study.