Both lipid-modified and free Sup-ODN were synthesized on a 1.0 micromole scale using an ABI 394 synthesizer. Diacyl lipid phosphoramidite was conjugated as a final ‘base’ on the 5’ end of oligos. Lipid phosphoramidite was coupled using the DNA synthesizer as previously described (20 (link)). After the synthesis, ODNs were cleaved from the solid support, deprotected, and purified by reverse phase HPLC using a C4 column (BioBasic-4, 200 mm x 4.6 mm, Thermo Scientific). A gradient of 20–60% (buffer B) in 10 min, was used for the unmodified ODN purification and for lipid-modified ODN, the gradient was set at 50–80% (Buffer B) for 10 mins and 80–100% for 5 mins. Buffer A: triethylammonium acetate (TEAA, 0.1 M, pH 7.0), buffer B: Methanol. Lipophilic ODNs typically eluted at 12 min while unconjugated oligos eluted at 5 min. Fluorescein label ODNs were synthesized using 3’-(6- Fluorescein) tagged controlled pore glass purchased form Chemgenes. Lipid-conjugated Sup-ODN (ODN A151: 5’- ttagggttagggttagggttagggt −3’) (11 (link)) and CpG ODN 1826 (CpG B ODN: 5’-tccatgacgttcctgacgtt-3’) (21 (link)) were synthesized by the above method and characterized by Mass Spec. All ODN sequences were modified by phosphothiolation to improve stability against nuclease degradation.
Biobasic 4
Manufactured by Thermo Fisher Scientific
Sourced in United States
The BioBasic-4 is a compact and versatile lab equipment designed for various scientific applications. It provides precise temperature control and customizable settings to support a range of experimental needs. The core function of the BioBasic-4 is to offer a consistent and reliable environment for temperature-sensitive procedures.
Automatically generated - may contain errors
5 protocols using biobasic 4
1
Synthesis and Purification of Lipid-Modified Oligonucleotides
2
Impurity Identification of a Met-PCT Compound using LC-MS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A Met-PCT
[3–116] solution (∼0.1 g/L in H2O/ACN 95:5,
v/v) was analyzed for potential impurity identification in LC-MS,
operated in electrospray positive mode (Q Exactive Focus). LC was
performed on a C4 analytical column (150 mm × 1 mm, 5 μm,
BioBasic-4, Thermo Scientific). The mobile phase consisted of 0.1%
FA (v/v) in water (solvent A) and 0.1% (v/v) FA in acetonitrile (solvent
B). The separation was achieved using a linear gradient from 25 to
60% of B over 37 min at a 40 μL/min flow rate. The experimental
MS parameters are summarized inTable S1 of the Supporting Information.
[3–116] solution (∼0.1 g/L in H2O/ACN 95:5,
v/v) was analyzed for potential impurity identification in LC-MS,
operated in electrospray positive mode (Q Exactive Focus). LC was
performed on a C4 analytical column (150 mm × 1 mm, 5 μm,
BioBasic-4, Thermo Scientific). The mobile phase consisted of 0.1%
FA (v/v) in water (solvent A) and 0.1% (v/v) FA in acetonitrile (solvent
B). The separation was achieved using a linear gradient from 25 to
60% of B over 37 min at a 40 μL/min flow rate. The experimental
MS parameters are summarized in
3
Analytical Biochemical Characterization of Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The general methodology used for analytical biochemical characterization (SDS-PAGE [33 (link)] and protein concentration by bicinchoninic acid (BCA) assay protein concentration by bicinchoninic acid (BCA) assay [34 (link)] has been described previously [10 (link)]. The purity of ageritin or quinoin was checked by RP-HPLC [35 (link)] using a BioBasic-4 (150 mm × 4.6 mm, 5-μm particle size; Thermo Fisher Scientific, Waltham, MA, USA) at 25 °C [10 (link)]. The following solvents were used: solvent A, Milli-Q water containing 0.1% TFA; solvent B, acetonitrile containing 0.1% TFA. Protein elution was performed using a linear gradient of solvent A and solvent B, from 5% to 65% of solvent B over 60 min at a flow rate of 1.0 mL/min, monitoring the absorbance at 214 nm.
4
Synthetic TLR ligands and conjugates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Synthetic ligands for TLR2, Pam2CSK4 and Pam3CSK4, and their biotinylated variants were purchased from Tocris Bioscience and InvivoGen. TLR9 ligand, CpG oligonucleotide 1826 (5′-tccatgacgttcctgacgtt-3′ with a phosphorothioated backbone) (CpG) and fluorescein (FAM)-labeled CpG, were commercially synthesized (Integrated DNA Technologies). Diacyl stearoyl (C18) lipid conjugated CpG (lipid-CpG) and FAM-labeled lipid-CpG were made as previously described by synthesizing diacyl C18 lipid phosphoramidite and conjugating to either CpG or CpG-FAM on a ABI 394 synthesizer on 1.0 micromole scale (11 (link)). Lipid-CpG was purified by reverse phase HPLC with a C4 column (BioBasic4, 200 mm × 4.6 mm, Thermo Scientific). A gradient eluent (Sigma-Aldrich) was implemented with 100 mM triethylamine-acetic acid buffer (pH 7.5) and acetonitrile (0–30 min, 10–100%).
5
DNA Synthesis and Cell Culture Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!