Qpcr rt master mix kit

qRT-PCR analysis was performed as described previously [27 (link)]. Briefly, Trizol reagent (ThermoFisher Scientific, MA, USA, #L15596026) was applied to extract total RNA. cDNA was then synthesized using a qPCR RT Master Mix kit (Toyobo, Osaka, Japan). Relative expression levels of mRNA were calculated using the 2-ΔΔCt method (Ct of GAPDH minus the Ct of the target genes) and normalized to the level of U6 mRNA determined as the 2-ΔΔCt. The primer sequences used were as follows: for p53, CAGCACATGACGGAGGTTGT (forward) and TCATCCAAATACTCCACACGC (reverse); for Col 1a1, TGGCAAAGATGGACTCAACG (forward) and TCACGGTCACGAACCACATT (reverse); for ALP, GCTCTGGAAAGTCCTTCAAAGC (forward) and TCTTCTTCCCTGGACACTGCC (reverse); for OCN, TCACACTCCTCGCCCTATTG (forward) and CTCCTGAAAGCCGATGTGGT (reverse); for Runx2, CTACTATGGCACTTCGTCAGGAT (forward) and ATCAGCGTCAACACCATCATT (reverse); and for GADPH, GGAAGCTTGTCATCAATGGAAATC (forward) and TGATGACCCTTTTGGCTCCC (reverse).

The 5 × 10⁵ LO2 cells were seeded in 6-well plates. After incubated for 24 h, the cells were treated with TGYP (500 μg/ml) for 48 h. Total RNAs were extracted using the RaPure Total RNA Mini Kit (Magen, CN) according the manufacturer’s instructions. The reverse transcription of total RNA to cDNA was performed with qPCR RT Master Mix kit (TOYOBO, JAN). RT-qPCR was performed using the Real-time PCR Detection System (Agilent Technologies, US) with the SYBR Green Real-time PCR Master Mix (TOYOBO, JAN). The primers used in this study are provided in Supplementary Table S5, using GAPDH as internal control gene. The experiments were performed in triplicate and repeated 3 times.

The BMDMs were harvested and prepared as single-cell suspensions after 5 min of digestion by 0.25% trypsin (Gibco) at 37°C. Subsequently, the purified cells were stained with APC-Cy7-conjugated anti-rat CD45 antibody (cat. no. 561588; BD Biosciences, San Jose, CA, USA) and FITC-conjugated anti-rat CD68 antibody (cat. no. MA5-28262; Invitrogen, Carlsbad, CA, USA) or stained with isotype control (cat. no. 557873, BD Biosciences and cat. no. 11-4714-81, Invitrogen). Flow cytometry was performed using a Beckman CytoFLEX Flow Cytometer (Beckman Coulter, Miami, FL, USA), and the results were analyzed with FlowJo software (FlowJo, Ashland, OR, USA). The total RNA of the cells was extracted using TRIzol reagent (Invitrogen), and complementary (c) DNA was synthesized using the qPCR RT Master Mix kit (TOYOBO, Osaka, Japan). PCR primers were designed and synthesized by Invitrogen (Thermo Fisher Scientific). qPCR analysis was performed according to the manufacturer's protocols using the KOD SYBR qPCR Mix (TOYOBO) in a LightCycler 480 (Roche, Basel, Switzerland). For analysis, the expression of target genes was normalized to that of GAPDH. The primer sequences for the target genes are illustrated in Table 1.

Total RNA of the cornea was extracted using Tissue Total RNA Isolation Kit V2 (Vazyme Medical Technology, Nanjing, China). RNA was reverse transcribed into cDNA using the qPCR RT Master Mix Kit (FSQ-301, Toyobo, Japan). qRT-PCR was performed using the Taq Pro Universal SYBR qPCR Master Mix (Vazyme Medical Technology, Nanjing, China) and conducted on ABI 7500 System. All experiments were repeated at least three times, and p < 0.05 indicated a statistically significant difference. Relative expression levels were calculated using the comparative threshold cycle (Ct) method. Human β-actin expression acted as an endogenous reference to normalize relative gene expression. Primer sets used in qRT-PCR are listed in Table S1.

RT-qPCR used B. subtilis 16S ribosomal RNA as the internal control. Total RNA was extracted from each sample using RNA fast200 Kit (FASTAGEN, Shanghai, China, Cat#220010 50), according to the manufacture’s instruction. Then, 5 μg of total RNA was reverse transcribed with qPCR RT Master Mix Kit (TOYOBO, Osaka, Japan, Cat#FSQ-301) for complementary DNA synthesis. RT- qPCR was performed in a 20 μL volume consisting of 10 μL 2X QuantiNova SYBR Green PCR Kit (QIAGEN, Hilden, Germany, Cat#208054), 8 μL RNA-free water, 1 μL cDNA template, and 0.5 μL of each primer pair according to the manufacturer’s procedure using CFX Connect Real-Time PCR System (BIO-RAD, Hercules, CA, USA). Three biological replicates were performed each with three technical replications. Relative differential expression levels of msyB were calculated based on the cycle threshold (C_T) values normalized with the control gene using the 2^−△△CT method.