Takara reagent

Total RNAs of the liver and kidney were isolated using a TRIzol reagent (Invitrogen, USA). 500 ng RNA was reversely transcribed into cDNA and amplified by using Takara reagent (Takara, Japan) according to the manufacture′s protocol; then, PCR amplification was performed by SYBR Premix ExTaqII kits (Takara, Japan). PCR was performed using the following thermal cycling conditions: 95°C 30 s; 40 cycles of denaturing at 95°C for 5 s; and annealing at 60°C for 30 s. PCR was performed using the following primers: IL-1β (F): TGACCTGGGCTGTCCTGATG, (R): GGTGCTCATGTCCTCATCCTG, product length: 220 bp; IL-6 (F): CTGCAAGAGACTTCCATCCAG, (R): AGTGGT ATAGACAGGTCTGTTG, product length: 131 bp; IL-12 (F): TGGTTTGCCATCGTTTTGCTG, (R): ACAGGTGAGGTTCACTGTTTCT, product length:123 bp; Tnf-α (F): CCCCAAAGGGATGAGAAGTTC, (R): GGCTTGTCACTCGAATTTTGAGA, product length: 148 bp; Ifn-γ (F): AAGCGTCATTGAATCACACCTG, (R): TGAC CTCAAACTTGGCAATACTC, product length: 92 bp; IL-13 (F): CACACAAGACCAGACTCCCCTG, (R): GGTTACAGAGGCCATGCAATATCC, product length: 155 bp; IL-23 (F): CCCGTATCCAGTGTGAAGATG, (R): CCCTTTGAAGATGTCAGAGTC, product length: 128 bp; IL-10 (F): GGGGCCAGTACAGCCGGGAAA, (R): CTGGCT GAAGGCAGTCCGCA, product length: 92 bp; GADPH (F): TGTGTCCGTCGTGGATCTGA, (R): TTGCTGTTGAAGTCGCAGGAG, product length: 150 bp. 2^−ΔΔCt values were calculated to represent the amounts of different target genes.

Total RNA was isolated from 100 mg (fresh weight) of excised mini Chinese cabbage seedling leaves by grinding with mortar and pestle in liquid nitrogen to obtain a fin paste using TaKaRa reagent (TaKaRa Bio, Japan) according to the manufacturer’s instructions. Each treatment was replicated three times. Primers designed for the genes and reference genes are detailed in Table 1. Each reaction (20 μL total volume) consisted of 10 μL SYBR Premix Ex Taq II, 2 μL of diluted cDNA and 0.8 μL of forward and reserve primers. PCR amplification conditions were as follows: 1 min at 95 °C followed by 40 cycles of 5s at 95 °C and 20 s at 60 °C with data collection at the annealing step. After the 40 cycles, the dissociation/melting curve stage with 0 s at 95 °C, 15 s at 65 °C, 0 s at 95 °C and 30 s at 50 °C was included. The relative quantification of mRNA levels is based on the method of Livak and Schmittgen [44 (link)]. The expression level relative to the control for each sample was expressed as 2^−ΔΔCt.

Total RNA was isolated from the occluded vein grafts and intraoperative spare great saphenous veins of patients using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. Total RNA from primary HVSMCs was isolated using a Takara reagent according to the manufacturer’s protocol (Takara, Shiga, Japan). Complementary DNA (cDNA) was reverse transcribed from 2 μg of RNA by using the Takara reverse transcription system (Takara), and real-time PCR was performed with SYBR Green mix on the 7500 real-time PCR system (Applied Biosystems; ABI, Waltham, Ma, USA). ITGB2 expression was normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression, and relative expression levels were calculated with the 2-^ΔΔCT method.
The primer sequences were as follows: ITGB2 forward: 5′-GAGTGCCTGAAGTTCGAAAAG-3′, reverse 5′- TCATCCACATAGATGAGGTAGC-3′; GAPDH forward: 5′- AAAAGCATCACCCGGAGGAGAA-3′, reverse 5′- AAGGAAATGAATGGGCAGCCG-3′.