Biophotometer plus 6132

All animal experiments were performed in accordance with the ethics committee of Institute of Hydrobiology, Chinese Academy of Sciences. One wild schizothoracine fish (G. pachycheilus) was sampled from Gansu Fisheries and Science Research Institute, Lanzhou, Gansu, China. To obtain as many expressed genes as possible, five different types of organs (heart, brain, liver, kidney, and spleen) were sampled and stored in RNAlater (QIAGEN) immediately. Total RNA was isolated using the SV Total RNA Isolation System (Promega) according to the manufacturer’s protocol and the quality of RNA was measured using electrophoresis and the BioPhotometer plus 6132 (Eppendorf, Germany). Poly (A) mRNA was purified using Oligo (dT) magnetic beads and interrupted into short fragments. Subsequently, the first-strand cDNA was synthesized using random hexamer primer and then second-strand cDNA was generated. Finally, the paired-end cDNA library was prepared according to the Illumina’s protocols and sequenced (101 bp read length) on Illumina HiSeq 2000 platform. The sequencing data have been deposited into the National Center for Biotechnology Information (NCBI) Sequence Read Archive database (Accession No. SRR1583887)

To assess the quantity and purity of the RNA, lysates of discordant samples underwent spectrophotometric analysis (Bio Photometer Plus 6132; Eppendorf, Hamburg, Germany) to obtain the total RNA concentration (ng/μL) and the 260:280 ratio, while automatic electrophoresis (Agilent 2100 Bioanalyzer System; Agilent Technologies, Santa Clara, CA, USA) was performed to obtain the total RNA concentration (ng/μL), the 28S/18S-ratio, and the RNA integrity number (RIN).

For RNA isolation, 2–4 × 10⁶ cells or 2–3 mm tissue slices were collected and lysed in 1 mL TRIzol^® Reagent (Ambion^®, Life technologies™, Carlsbad, CA, USA), and RNA was isolated as instructed by the manufacturer of TRIzol. RNA concentrations were determined by photometric measurements (BioPhotometer plus 6132, Eppendorf, Germany). Total RNA was reverse transcribed by M-MuLV Reverse Transcriptase (GeneON, Ludwigshafen am Rhein, Germany) in a MyiQ™ cycler (BIO-RAD Laboratories, Inc., Hercules, CA, USA) following the manufacturer’s instructions. PCR of cDNA transcripts was performed in a MyiQ™ cycler (BIO-RAD Laboratories, Inc., USA) using Go-Taq master mix (Promega, Madison, WI, USA) and the following forward: 5′-CAC ACT GAG GTG CAT AGC GT-3′ and reverse: 5′-TGA TGA CCG CTT GCT CCT GT-3′ primers for NGF, and forward: ACCCTGAAGTACCCCATCGA; reverse: TGTCACCTTCACCGTTCCAG for the housekeeping gene ACTB. The primers were synthesized by Invitrogen™ (Darmstadt, Germany). The PCR setup and the cycling conditions were instructed in the manual of Go-Taq. PCR products were electrophoresed in 1% agarose run in Tris-Acetate-EDTA buffer for one hour at 100 volts. Gels were photographed in an Azure C500 (Azure Biosystems, Dublin, CA, USA).