Maxiscript sp6 t7 transcription kit

Fragments of pri-miR-181a, pri-miR-181c, pri-miR-181a-AS, and pri-miR-181c-AS were amplified using primers containing T7 and SP6 promoter sequences(BioSune, Shanghai, China). The templates were transcribed using a MAXIscript™ SP6/T7 Transcription Kit in vitro (Thermo Fisher Scientific, MA, USA). N6-methyl-ATP (m⁶A) (Biorbit, orb65363) was used instead of ATP in the in vitro transcription reaction to achieve pri-miR-181a-m⁶A and pri-miR-181c-m⁶A. BMSCs (1.5 × 10⁷ cells) were collected and lysed. A Pierce™ Magnetic RNA-Protein Pull-Down Kit was used to complete the RNA pull-down experiment. RNA was first labeled with the end of the desulfurizing biotin. The labeled RNA was captured onto microbeads for 60 min at room temperature to prepare them for protein binding. The RNA-bound beads were equilibrated in protein RNA-binding buffer, and then the protein lysates were added to incubate together overnight at 4 °C. After washing with ice-cold PBS three times, the samples were eluted using sodium dodecyl sulfate–polyacrylamide gel electrophoresis loading buffer. Eluted samples were prepared for WB.

WISH was performed as described previously [46 (link)]. Digoxigenin-labeled RNA probes for sox10, mitfa, tyr, and dct were transcribed in vitro using the MAXIscript SP6/T7 Transcription Kit (AM1322, Invitrogen). In situ hybridization signals were detected using BM-Purple (11442074001, Roche).

Expression vectors for full-length ANRIL used for the in vitro synthesis of RNA were provided by GenePharma Technology. The lncRNAs were transcribed in vitro using a MAXIscript™ SP6/T7 Transcription Kit (Invitrogen, AM1320, USA) and were biotinylated with a Pierce RNA 3′ End Desthiobiotinylation Kit (Thermo Fisher Scientific, 20163) according to the manufacturer’s instructions. The proteins were extracted from HUVECs using Pierce IP Lysis Buffer (Thermo Fisher Scientific). Then, RNA pull-down assays were performed with a Pierce Magnetic RNA-Protein Pull-Down Kit (Thermo Fisher Scientific, 20164). Briefly, the biotinylated lncRNAs were captured with streptavidin magnetic beads and incubated with the cell lysates at 4 °C overnight. Then, the mixture was washed and eluted. The eluate was subjected to Western blotting analysis.

Whole-mount in situ hybridization (WISH) was performed as previously described [54 (link)]. In brief, all DNA templates for the RNA probes were amplified from the cDNA library of whole embryos at 4 dpf, and cloned into the pGEM®-T Easy plasmid (Promega, A1360). The sequences of the in vitro transcription templates were validated by Sanger sequencing. The RNA probes were transcribed using the MAXIscript™ SP6/T7 Transcription Kit (Invitrogen, USA). The primer sequences used to amplify the DNA templates for synthesizing RNA probes were as follows: tulp1a: forward, AAAGAAGAAAGGCAAAGG; reverse, GTATCGGCACTCGCTCA. tulp1b: forward, AAAGAAAGCGGCCAAATCCGA; reverse, CGGGTCACTTTGCACTTCAC. tekt2: forward, GCCGGGCAAGGGAAGAGATG; reverse, AGCGCTGCCGGGTCTGGT.

In situ hybridization was performed on 10 μm cryosections of zebrafish eyes. Briefly, zebrafish embryos were fixed in 4% paraformaldehyde overnight at 4°C. The next day, the fixed embryos were washed three times with PBS and dehydrated in 30% sucrose. Then, the embryos were embedded in OCT (Invitrogen) before being sectioned at 10 μm with a Leica cryostat (Leica CM1860, Leica Microsystems, Germany). For whole-mount in situ hybridization, the steps were performed as previously described (Thisse and Thisse, 2008 (link)).
To generate in situ probes, PCR products of γ-tubulin, tubgcp2, tubgcp3, pcna, vsx2, col15a1b, ccnd1, atoh7, and cdkn1c were amplified from cDNA and subcloned into pGEM-T Easy vector (A1360, Promega). Probe plasmids were digested with restriction enzyme to make DNA templates. Digoxigenin-labeled RNA probes were generated by in vitro transcription using the MAXIscript SP6/T7 Transcription Kit (AM1322, Invitrogen). In situ hybridization signals were detected by using NBT/BCIP (11681451001, Roche) for sections and BM-Purple (11442074001, Roche) for whole-mount embryos.