Log In Sign up
The largest database of trusted experimental protocols

Pspcas9 bb 2a puro px

Manufactured by Addgene
Visit Supplier

PSpCas9(BB)-2A-Puro (PX) is a plasmid vector that expresses the SpCas9 protein and a puromycin resistance gene. The SpCas9 protein is a RNA-guided DNA endonuclease derived from Streptococcus pyogenes that can be used for genome editing applications.

Automatically generated - may contain errors

Lab products found in correlation

Pspcas9 bb 2a gfp px458, by Addgene (2 mentions)

Spelling variants of this product

PSpCas9(BB)-2A-Puro (83 citations)

3 protocols using pspcas9 bb 2a puro px

1

CRISPR-Cas9 Deletion of AMPK-β Subunits

Check if the same lab product or an alternative is used in the 5 most similar protocols
The genes (PRKAB1 and PRKAB2) were deleted from HEK293 cells using the CRISPR-Cas9 system28 (link). Targeting nucleotides for β1 were caccGTGAGCGCGCCGCGCTGGAG (a.a. 6-13) and caccGTGGCC ATAAGACGCCCCGG (a.a. 15-22) and for β2 were caccGCCAAGGCTGCACG CTCCGA (a.a. 15-27) and caccGTCGCTGGTGGTGTTTCCCA, (a.a. 1-7). Nucleotides were annealed to their complements containing the cloning tag aaac, and inserted into the back-to-back BbsI restriction sites of pSpCas9(BB)-2A-Puro (PX459) and pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmids #48139 and #48138). Cells were transfected with a 1:1 mixture of GFP and Puro constructs containing the CRISPR oligonucleotides, using 2-3 µg DNA in Fugene 6 transfection reagent per well of a 6 well plate. After 24 h, transfection was verified by fluorescence microscopy and cells trypsinised from the plates and re-plated into 15 cm dishes in the presence of puromycin (0.6 µg/ml). After 24 h the medium was changed, fresh puromycin added and cells grown for a further 48 h, at which time cells were transferred to medium without puromycin and allowed to grow until colonies formed. Colonies (20-30) were picked and expanded until large enough to allow freezing of stocks and analysis of AMPK-β2 expression by Western blot and immunoprecipitate kinase assay.
Zhang C.S., Hawley S.A., Zong Y., Li M., Wang Z., Gray A., Ma T., Cui J., Feng J.W., Zhu M., Wu Y.Q., Li T.Y., Ye Z., Lin S.Y., Yin H., Piao H.L., Hardie D.G, & Lin S.C. (2017). Fructose-1,6-bisphosphate and aldolase mediate glucose sensing by AMPK. Nature, 548(7665), 112-116.
+ Open protocol
+ Expand
2

CRISPR-Mediated Wdr5 3xFLAG Knock-In

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
pSpCas9(BB)-2A-Puro (pX459V2.0, Addgene plasmid #48139) was used for CRISPR/Cas9-mediated 3xFLAG knock-in to the 5´-end of the Wdr5 coding region as described previously [28 (link),65 (link)]. Primers (Wdr5-CRI-F, CACCGGAGAAGAAGCCAGAGACAG and Wdr5-CRI-R, AAACCTGTCTCTGGCTTCTTCTCC) were annealed and inserted into BbsI site in pX459ver2 modified with the sgRNA(F+E) mutation for higher targeting efficiency [66 (link)]. Single-stranded oligodeoxynucleotide (ssODN) Wdr5-3xFLAG-KI (TCCATTGTGACTCCCCCTTCACGGTGTCCTGCCCTGTGGGCTTCAGAGCCATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGATATCGATTACAAGGATGACGATGACAAGGCCACAGAGGAGAAGAAGCCAGAGACAGAGGCTGCAAGAGCACAGCCCACTCCTTCCTCATCAGCCACACAGAGCAAGGTA) was used for the homology directed repair (HDR)-mediated FLAG knock-in. The 3xFLAG knockin at the Wdr5 locus was confirmed by genomic PCR using primer pair (Wdr5-T7E1-F1, GGCCCCTTACTATAGAGTTCAGC and Wdr5-T7E1-R1, CCACTGTTGTGTGCTCAGAAAT) and DNA sequencing.
Yue M., Ogawa A., Yamada N., Charles Richard J.L., Barski A, & Ogawa Y. (2017). Xist RNA repeat E is essential for ASH2L recruitment to the inactive X and regulates histone modifications and escape gene expression. PLoS Genetics, 13(7), e1006890.
+ Open protocol
+ Expand
3

CRISPR-Cas9 Deletion of AMPK-β Subunits

Check if the same lab product or an alternative is used in the 5 most similar protocols
The genes (PRKAB1 and PRKAB2) were deleted from HEK293 cells using the CRISPR-Cas9 system28 (link). Targeting nucleotides for β1 were caccGTGAGCGCGCCGCGCTGGAG (a.a. 6-13) and caccGTGGCC ATAAGACGCCCCGG (a.a. 15-22) and for β2 were caccGCCAAGGCTGCACG CTCCGA (a.a. 15-27) and caccGTCGCTGGTGGTGTTTCCCA, (a.a. 1-7). Nucleotides were annealed to their complements containing the cloning tag aaac, and inserted into the back-to-back BbsI restriction sites of pSpCas9(BB)-2A-Puro (PX459) and pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmids #48139 and #48138). Cells were transfected with a 1:1 mixture of GFP and Puro constructs containing the CRISPR oligonucleotides, using 2-3 µg DNA in Fugene 6 transfection reagent per well of a 6 well plate. After 24 h, transfection was verified by fluorescence microscopy and cells trypsinised from the plates and re-plated into 15 cm dishes in the presence of puromycin (0.6 µg/ml). After 24 h the medium was changed, fresh puromycin added and cells grown for a further 48 h, at which time cells were transferred to medium without puromycin and allowed to grow until colonies formed. Colonies (20-30) were picked and expanded until large enough to allow freezing of stocks and analysis of AMPK-β2 expression by Western blot and immunoprecipitate kinase assay.
Zhang C.S., Hawley S.A., Zong Y., Li M., Wang Z., Gray A., Ma T., Cui J., Feng J.W., Zhu M., Wu Y.Q., Li T.Y., Ye Z., Lin S.Y., Yin H., Piao H.L., Hardie D.G, & Lin S.C. (2017). Fructose-1,6-bisphosphate and aldolase mediate glucose sensing by AMPK. Nature, 548(7665), 112-116.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!