All sera (patient and healthy control) were stored at − 80 °C and thawed for re-aliquoting once prior to assessment. To ensure consistency, cytokines were assessed on a single run by one operator with a single multi-channel pipette (freshly calibrated) after a single freeze–thaw cycle for time points 1–19, and then a second run for the last two time points. Enzyme-linked immunosorbent assay (ELISA) with an ELx808TM absorbance microplate reader (BioTek Instruments Inc, USA) or a cytokine bead array was used for quantitative determination of cytokines as per manufacturer’s instructions (Supplementary Table 2). ELISA determinations were done in duplicate and on different plates to account for plate-to-plate variation. Method controls and normal control samples were included on each test plate in addition to standard controls for calibration. Normal controls and method controls were also included in cytokine bead array with samples tested once.
Elx808tm absorbance microplate reader
Manufactured by Agilent Technologies
Sourced in United States
The ELx808TM Absorbance Microplate Reader is a versatile laboratory instrument designed for measuring the absorbance of samples in microplates. It features a broad wavelength range, allowing for various absorbance-based assays and applications.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Elisa, by R&D Systems (1 mentions)
Em 2010 microscope, by JEOL (1 mentions)
Icps 7500 spectrometer, by Shimadzu (1 mentions)
Elisa kit, by R&D Systems (1 mentions)
P0397, by Agilent Technologies (1 mentions)
E0354, by Agilent Technologies (1 mentions)
Nunc immuno plate, by Thermo Fisher Scientific (1 mentions)
Kc junior software, by Agilent Technologies (1 mentions)
Gen5tm data analysis software, by Agilent Technologies (1 mentions)
Pyruvate kinase lactate dehydrogenase mix, by Merck Group (1 mentions)
Myokinase from chicken muscle, by Merck Group (1 mentions)
Alkaline phosphatase assay kit, by Nanjing Jiancheng (1 mentions)
Bepridil, by Merck Group (1 mentions)
13 protocols using elx808tm absorbance microplate reader
1
Cytokine Quantification in Frozen Sera
2
Evaluating siRNA-mediated GRIN2A Knockdown in C918 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human UM cell line C918 and the human retinal pigment epithelium cell line ARPE-19 were cultured in RPMI-1640 medium with 10% FBS and 1% penicillin/streptomycin in an incubator at 37°C under 5% CO2, and split when they reached 80% confluence. This study did not involve human or animal subjects, and thus, no ethical approval was required. The study protocol adhered to the guidelines established by the journal.
C918 cells (4×104 cells/ml) were transfected with Lipofectamine 2000 (Invitrogen) plus 50 nM small interfering RNA (siRNA) targeting GRIN2A gene (Small interfering RNA sequence: siRNA1, Sense ‘CGGCAGAAGGAUAACCUCAAU’, Antisense ‘AUUGAGGUUAUCCUUCUGCCG’, siRNA2, Sense ‘CGGAGAGAAACAUUCGGAAUA’, Antisense ‘UAUUCCGAAUGUUUCUCUCCG’) or with the corresponding nonspecific control siRNA (siRNA nonspecific) (Tsingke Biotechnology Co., Ltd.).
To ensure cells adhered to the plates, they were seeded onto 96-well plates (2000 cells/well) and incubated for 12 h. The CCK-8 solution was introduced to the wells at the designated timepoint. Following this, the plate was incubated at 37°C for another 2 h. The viability of the cells was then determined using an ELx808TM Absorbance Microplate Reader (BioTek) to measure their optical absorbance at 450 nm.
C918 cells (4×104 cells/ml) were transfected with Lipofectamine 2000 (Invitrogen) plus 50 nM small interfering RNA (siRNA) targeting GRIN2A gene (Small interfering RNA sequence: siRNA1, Sense ‘CGGCAGAAGGAUAACCUCAAU’, Antisense ‘AUUGAGGUUAUCCUUCUGCCG’, siRNA2, Sense ‘CGGAGAGAAACAUUCGGAAUA’, Antisense ‘UAUUCCGAAUGUUUCUCUCCG’) or with the corresponding nonspecific control siRNA (siRNA nonspecific) (Tsingke Biotechnology Co., Ltd.).
To ensure cells adhered to the plates, they were seeded onto 96-well plates (2000 cells/well) and incubated for 12 h. The CCK-8 solution was introduced to the wells at the designated timepoint. Following this, the plate was incubated at 37°C for another 2 h. The viability of the cells was then determined using an ELx808TM Absorbance Microplate Reader (BioTek) to measure their optical absorbance at 450 nm.
3
Quantification of Soluble Axl in Renal Disease
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Serum from patients was collected at the time of baseline and post-treatment renal biopsies, and from controls at the time of enrolment. The serum samples were cryopreserved at -80°C until the analysis. Serum levels of sAxl were determined using enzyme-linked immunosorbent assay (ELISA) (R&D Systems, Inc., Minneapolis, Minnesota, USA; catalogue number: DY154). Serum samples were diluted 1:50. All assays were undertaken according to the manufacturer's protocol. Optical density at a wavelength of 450 nm was measured using an ELx808TM Absorbance Microplate Reader (BioTek Instruments, Inc., Winooski, Vermont, USA), and the concentrations of the samples were calculated using a standard curve. All samples were analysed in duplicate and all experiments were performed in a blinded manner.
4
Multitechnique Nanomaterial Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transmission electron microscopy (TEM) and high-resolution TEM (HR-TEM) images were acquired using a JEOL EM-2010 microscope (JEOL, Tokyo, Japan) at an accelerating voltage of 200 kV. The powder X-ray diffraction (XRD) pattern was obtained by a Rigaku D/Max-3C diffractometer (Cu Kα radiation, λ = 0.15418 nm, Rigaku Co. Ltd., Tokyo, Japan). The UV-Vis absorption spectra were acquired by a Jasco V-570-type spectrophotometer (Jasco SLM-468, Tokyo, Japan). Elemental analysis was performed by inductively coupled plasma-atomic emission spectroscopy (ICP-AES) using an ICPS-7500 spectrometer (Shimadzu, Kyoto, Japan). The MTT cell proliferation assay was performed by an ELx808TM absorbance microplate reader (Biotek Instruments Inc., Winooski, VT, USA).
5
Serum sTNFR2 Measurement by ELISA
6
ELISA for Quantifying H. pylori Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the ELISA, flat-bottomed 96-well NUNC-immuno plates (Nalge Nunc International, Roskilde, Denmark) were coated with whole cell lysates of each of the 3 H. pylori strains (5 µg per well) in carbonate-bicarbonate buffer (pH 9.6) for 90 min at 37°C. The mAbs were serially diluted in PBS containing 0.25% Tween-20 (T-PBS) and added to each well, and then, the plates were incubated for 90 min at 37°C. They were incubated further for 30 min with biotinylated rabbit anti-mouse immunoglobulins (E0354, DAKO, Glostrup, Denmark), followed by incubation for 30 min with horseradish peroxidase-conjugated streptavidin (P0397, DAKO), both at room temperature. The plates were washed with T-PBS both before and after each step. After the reaction, citrate phosphate buffer (pH 5.4) containing 0.3% o-phenylenediamine dihydrochloride (MilliporeSigma Co.) and 0.012% H2O2 was added to each well, and the plates were incubated in the dark for 15 min at room temperature. The reaction was stopped by adding 25 µl of 2N HCl to each well. The plates were read at 490 nm on an ELx 808 TM Absorbance Microplate Reader (BioTek, Tokyo, Japan).
7
Zymolase Assay for CdSe/ZnS and AgNPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Zymolase assay was performed by culturing yeast cells in 3 mL of SD-Glucose overnight in a shaking incubator at 30 °C. The cell culture was then centrifuged at 2000× g for ten minutes, and the resulting cell pellet was re-suspended with 2X TE buffer to an OD of 1.0. The suspended cells were applied to a 96-well plate in a quadruplicate manner. To test the effects of CdSe/ZnS, the following samples were prepared: non-treated controls (cells with TE buffer), 10 µg/mL CdSe/ZnS-treated cells, and 20 µg/mL CdSe/ZnS-treated cells. To test the effects of AgNPs, samples prepared in a 96-well plate consisted of non-treated controls and 2.5 µg/mL and 5 µg/mL AgNP-treated cells. Cell walls were degraded by the introduction of Zymolase at a concentration of 0.5 µg/mL and incubated in an ELx808TM absorbance microplate reader (Biotek, Winooski, VT) for four hours at 30 °C. During the incubation period, the optical density (594 nm) was measured in 30 min intervals, and each sample was independently tested without the use of Zymolase to serve as a control. The resulting changes in optical densities were recorded and averaged for each sample before plotting into a line graph.
8
Hippocampal ELISA Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the tissue samples were collected after the intervention for further experiments. The hippocampi were homogenized on ice after cold PBS washing and subjected to centrifuge, then the supernatants were collected for ELISA. The ELISA procedures were followed as the manufacturer’s instructions (Elabscience Biotechnology, China). Briefly, 50 µL of prepared standards and samples were added to wells followed by adding 50 µL of diluted biotinylated detection antibody and incubate at room temperature for 90 min, then washing the wells thoroughly four times after decanting solutions. 100 µL of diluted HRP conjugate was added and the plate was incubated for 45 min. After incubation, 5 times of washing were performed and 90 µL of the chromogenic substrate (TMB) was added to each well with 30 mins incubation at room temperature in dark. Finally, 50 µL of stop solution was added to each well to stop the reaction. The absorbance of each well at 450 nm was read in an ELx808TM absorbance microplate reader (BioTek Instruments, USA). A four-parameter logistic curve fit to the standards using KC junior software (BioTek Instruments, USA) was used to calculate concentrations of HT or BDNF for all the samples.
9
Measuring AtACS Activity via Coupled Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AtACS activity was measured by coupling the acetate- and CoA-dependent formation of AMP from ATP, to the oxidation of NADH, using the reactions catalyzed by myokinase, lactate dehydrogenase and pyruvate kinase (Sofeo et al., 2019 (link)). In brief, assays were performed at 37°C in a final volume of 100 μL, in individual wells of 96-well microtiter dishes. The absorbance of NADH was measured at 340 nm using a BioTek ELx808TM Absorbance Microplate Reader, and data were collected and analyzed with Gen5TM Data Analysis software (BioTek Instruments, Winooski, VT). The reaction mix initially contained 50 mM Tris-HCl pH 7.5, 5% (v/v) ethanol, 5 mM Tris(2-carboxylethyl) phosphine hydrochloride (Thermo Fisher Scientific Inc. Waltham, MA), 6 mM MgCl2, 5 mM ATP, 5 mM phospho(enol)pyruvate, 0.4 mM NADH, 2–20 U Pyruvate Kinase/Lactate Dehydrogenase mix (Sigma-Aldrich Co., St. Louis, MO), 1U Myokinase from chicken muscle (Sigma-Aldrich Co., St. Louis, MO) and 5 μg of recombinant atACS protein. After monitoring the initial background change A340, ACS activity was initiated by the addition of 2.5 mM CoA, and progress of this reaction was monitored as a decrease in A340. All data were collected from three independent assays, and all raw data collected for this study are provided in Supplementary Table S1 .
10
Cell Viability Assessment Using CCK-8
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells (3000 cells/well) were seeded in 96-well plates and cultured for 24 h to adhere to the wall. After different treatments, CCK-8 solution (10 μL/well) was added and the plate was placed in 37°C incubation for another 2 h. Subsequently, cell viability was evaluated by measuring the optical absorbance at 450 nm using an ELx808TM Absorbance Microplate Reader (BioTek, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!