Ab2765

Manufactured by Abcam

Sourced in Netherlands, United Kingdom, United States

Ab2765 is a primary antibody product manufactured by Abcam. It is a polyclonal antibody raised against a specific target antigen. The antibody is suitable for use in various immunoassay applications.

Automatically generated - may contain errors

Lab products found in correlation

7 protocols using ab2765

Probing YAP Promoter Binding by EMSA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Electrophoretic mobility shift assay (EMSA) was performed as previously published.¹⁸ Nuclear extracts were prepared using NE‐PER™ Nuclear and Cytoplasmic Extraction Kit (78835, Thermo Fish Scientific), following standard procedures. Briefly, cells were harvested using trypsin‐EDTA and centrifuged at 500 g for 5 minutes. Ice‐cold CER I was added to cell pellet and vortexed vigorously to fully suspend prior to addition of CER II. Then, the tube was vortexed for 5 seconds vigorously and centrifuged for 5 minutes at 16 000 g. Lastly, supernatant (cytoplasmic extract) was removed and ice‐cold NER was added to lyse nuclear pellet to obtain nuclear protein. DNA probes representing fragments of the YAP promoter were synthesized and 5′ end‐labelled with DyLight 800. In addition, control non‐labelled DNA probes were used as competitors. The extracted proteins were pre‐incubated with progesterone receptor antibody (ab2765, Abcam) or IgG before being incubated with labelled probe (50 nmol/L) or control non‐labelled DNA probes at 200‐fold molar excess. Then, the protein‐bound and free DNAs were separated on 6% polyacrylamide gel in the dark. The bands in the gels were visualized using Odyssey Infrared Imaging System (Li‐COR Biosciences). The sequence of the DNA probe was 5′‐AACTATTTTTTGTTCTGTACCTCATGACTT‐3′.

Lan C., Cao N., Chen C., Qu S., Fan C., Luo H., Zeng A., Yu C., Xue Y., Ren H., Li L., Wang H., Jose P.A., Xu Z, & Zeng C. (2020). Progesterone, via yes‐associated protein, promotes cardiomyocyte proliferation and cardiac repair. Cell Proliferation, 53(11), e12910.

+ Open protocol

+ Expand

Immunohistochemistry analysis of stem cell markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

All samples were fixed in 4% paraformaldehyde overnight at 4°C and then dehydrated in different concentrations of ethanol. Immunohistochemistry staining and analytical methods were performed according to the protocol of the UltraSensitiveTM SP（Mouse/Rabbit）immunohistochemistry (IHC) kit (Maxim). Anti‐OCT4 (1:1000; Abcam, ab181557), ISL‐1 (1:200; Abcam, ab178400), ERα (1:200; Abcam, ab108398), PR (1:200; Abcam, ab2765), HER2 (1:200; Abcam, ab16662) and Ki67 (1:200; Abcam, ab15580) antibodies were used in the experiments.

Jin X., Li Y., Guo Y., Jia Y., Qu H., Lu Y., Song P., Zhang X., Shao Y., Qi D., Xu W, & Quan C. (2019). ERα is required for suppressing OCT4‐induced proliferation of breast cancer cells via DNMT1/ISL1/ERK axis. Cell Proliferation, 52(4), e12612.

+ Open protocol

+ Expand

IHC Analysis of KLF9 and PR in EC Tumors

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fifty-two EC tumor samples were immunostained with KLF9 and PR antibodies. The IHC procedure and scoring of protein expression were performed as previously described (21 (link)). Tissue microarray sections were incubated with primary polyclonal rabbit anti-KLF9 antibody (ab26074, Abcam) and monoclonal mouse anti-PR antibody (ab2765, Abcam) overnight at 4 °C, followed by incubation with biotinylated anti-rabbit and anti-mouse secondary antibody at 37 °C for 30 min respectively. Sections were then incubated with a streptavidin-horseradish peroxidase complex, colorized with 3,3-diaminobenzidine (DAB) chromogen solution and counterstained with hematoxylin. Results were analyzed as previously described. Briefly, the percentage of KLF9 and PR positive cells was scored as follow: 0 for 0%, 1 for 1–33%, 2 for 34–66% and 3 for 67–100%. The intensity of KLF9 and PR staining was also scored as follows: 0 for negative staining, 1 for yellow color staining, 2 for light brown color staining and 3 for brown color staining. The product of the staining intensity and percentage gave rise to the IHC score (IHS). The final results of IHC analysis were defined using a two level system following the IHS: <4 indicates low expression, while 4–12 indicates high expression. Negative controls were employed by replacement of the primary antibody with PBS.

Yan X., Zhang H., Ke J., Zhang Y., Dai C., Zhu M., Jiang F., Zhu H., Zhang L., Zuo X., Li W., Yin X, & Wan X. (2020). Progesterone receptor inhibits the proliferation and invasion of endometrial cancer cells by up regulating Krüppel-like factor 9. Translational Cancer Research, 9(4), 2220-2230.

+ Open protocol

+ Expand

Characterization of Heterogeneous Ovine Stromal-Derived Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Heterogeneous SF-SCs were isolated from the femurs of a 6–8-week-old sheep fetus (obtained at the local abattoir) by flushing with L-15 medium supplemented with Anti-Anti (Thermo Fisher Scientific). Cells were then expanded in vitro and verified for multipotency according to differentiation methods for chondrogenesis^{61 (link)}, osteogenesis^{62 (link)}, and myogenesis^{63 (link)}. Differentiated and undifferentiated SF-SCs were fixed in 4% buffered formaldehyde and stained with a wide range of primary antibodies (1 h at room temperature) from Abcam (Amsterdam, Netherlands), including α-SMA (ab32575; 1:500), vimentin (ab8798; 1:100), CD166 (ab235957; 1:200), Ki67 (ab15580; 1:300), estrogen receptor-α (ER-α; ab66102; 1:100), ER-β (ab187291; 1:100), progesterone receptor (PR; ab2765; 1:100), cytokeratin (ab9377; 1:1000), MyoD1 (ab16148, 1:100), RANK (ab13918, 1:100), and DMP1 (ab103203, 1:100). Each primary antibody was conjugated with either CY3 or Alexa Fluor 488 secondary antibodies (Thermo Fisher; 1:300) and DNA was labeled with DAPI. Chondrogenesis was evaluated after alcian blue staining using standard methods.

Padma A.M., Carrière L., Krokström Karlsson F., Sehic E., Bandstein S., Tiemann T.T., Oltean M., Song M.J., Brännström M, & Hellström M. (2021). Towards a bioengineered uterus: bioactive sheep uterus scaffolds are effectively recellularized by enzymatic preconditioning. NPJ Regenerative Medicine, 6, 26.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation of Progesterone Receptor

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP assay was performed using the ChIP assay kit according to the instruction (Millipore, USA). Anti-PR was obtained from Abcam (ab2765, Abcam). The input genomic DNA and the immunoprecipitated DNA was amplified by PCR. The PCR products were subjected to gel electrophoresis.

+ Open protocol

+ Expand

Immunohistochemical Analysis of Cancer Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

H&E staining and IHC staining were performed as previously described [25 (link)] with the following primary antibodies: anti-Ki67 (ab16667, Abcam, Cambridge, UK), anti-PR (ab2765, Abcam), and anti-5-hmC (GT13612, GeneTex, Irvine, CA, USA). Semi-quantitative optical analysis was performed as previously described [22 (link)].

Cheng Y., Xie L., Xu Z., Hao M., Yang B., Shan W., Wang Y., Lv Q, & Chen X. (2022). NrCAM secreted by endometrial stromal cells enhances the progestin sensitivity of endometrial cancer cells through epigenetic modulation of PRB. Cancer Gene Therapy, 29(10), 1452-1462.

+ Open protocol

+ Expand

Immunofluorescence and Immunohistochemistry of DNA Damage and Cellular Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

The tissue sections or adherent cells were washed with PBS after treatment, fixed with 4% paraformaldehyde, and permeabilized with 0.1% Triton X-100 in PBS. The samples were incubated with primary antibodies targeting γ-H2AX ( ab81299, Abcam, Cambridge, MA, USA; 1:200), SCD1 (ab19862, Abcam; 1:200), Ki67 (ab16667, Abcam; 1:500), GPX4 (ab125066, Abcam; 1:200), and PR (ab2765, Abcam; 1:200), respectively, overnight at 4 °C. IF was followed by incubation with fluorescently labeled secondary antibodies (A11034, Invitrogen, Eugene, OR, USA; 1:1,000) in the dark for 1 h. Then, counterstaining was performed with 4′,6-diamidino-2-phenylindole (DAPI). Cell slides were analyzed by laser scanning confocal microscopy. IHC incubated with enhanced enzyme-labeled goat anti-mouse/rabbit immunoglobulin G (AWS0003a/AWS0002a, Abiowell; 1:1,000) at room temperature for 20 min, with subsequent staining with the DAB (3,3′-diaminobenzidine) kit (CWO125M, CWBIO).

Wu N., Zhang X., Fang C., Zhu M., Wang Z., Jian L., Tan W., Wang Y., Li H., Xu X., Zhou Y., Chu T.Y., Wang J, & Liao Q. (2024). Progesterone Enhances Niraparib Efficacy in Ovarian Cancer by Promoting Palmitoleic-Acid-Mediated Ferroptosis. Research, 7, 0371.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!