Mir 216a mimics

Manufactured by GenePharma

Sourced in China

MiR-216a mimics are small, chemically synthesized RNA molecules designed to mimic the natural function of the miR-216a microRNA. MiR-216a is a regulatory microRNA involved in various cellular processes. The MiR-216a mimics are used in research applications to study the biological role and effects of miR-216a in different cell types and disease models.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Lipofectamine 3000 reagent, by GenePharma (1 mentions) Sismad3, by GenePharma (1 mentions) Pcdna3.1 vector, by Thermo Fisher Scientific (1 mentions) Si nc, by GenePharma (1 mentions) Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions) Si dancr 1, by GenePharma (1 mentions) Si dancr 2, by GenePharma (1 mentions) Endothelial cell medium (ecm), by ScienCell (1 mentions) Mir nc, by GenePharma (1 mentions)

Spelling variants of this product

MiR-mimics (3 citations) MiR-216a-5p mimics (3 citations)

6 protocols using mir 216a mimics

Investigating Rb2's Effect on miR-216a and Smad3/IκBα

Check if the same lab product or an alternative is used in the 5 most similar protocols

To examine whether Rb2 could affect the target gene expression of miR-216a, PDL8 HUVECs were transfected with miR-216a mimics (Shanghai GenePharma Co., Ltd.) at a final concentration of 50 nM using Lipofectamine^® 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.). After incubation for 6 h at 37°C, cells were treated with Rb2 (10 µM) at 37°C for 48 h and harvested for expression analysis.
To evaluate the effect of Rb2 on the Smad3/IκBα pathway, PDL8 HUVECs were transfected with Smad3 siRNA (si-Smad3; Shanghai GenePharma Co., Ltd.) at a final concentration of 40 nM using Lipofectamine 3000 reagent. After incubation for 6 h at 37°C, cells were treated with Rb2 (10 µM) at 37°C for 48 h and then were harvested for expression analysis. The sequences were as follows: miR-216a mimics sense, 5′-UAAUCUCAGCUGGCAACUGUGA-3′ and anti-sense, 5′-ACAGUUGCCAGCUGAGAUUAUU-3′; and Smad3 siRNA sense, 5′-AGGACGAGGUCUGCGUGAAUCCCUA-3′ and anti-sense, 5′-UAGGGAUUCACGCAGACCUCGUCCU-3′.

Chen Y., Wang S., Yang S., Li R., Yang Y., Chen Y, & Zhang W. (2021). Inhibitory role of ginsenoside Rb2 in endothelial senescence and inflammation mediated by microRNA-216a. Molecular Medicine Reports, 23(6), 415.

+ Open protocol

+ Expand

Overexpression of LGR5 by miR-216a modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The miR-216a mimics and negative control (NC) were purchased from GenePharma (Shanghai, P.R. China). The cDNA of LGR5 without 3′-UTR was cloned into the pcDNA3.1 vector (Invitrogen, Carlsbad, CA, USA) to generate the pcDNA3.1-LGR5 vector. Cells were allowed to grow to 80% cell confluence before transfection. Cell transfection of miRNAs or the vector was conducted using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocols. The transfection efficacy was measured by RT-qPCR or Western blot after 48 h of transfection.

Zhang J., Xu K., Shi L., Zhang L., Zhao Z., Xu H., Liang F., Li H., Zhao Y., Xu X, & Tian Y. (2017). Overexpression of MicroRNA-216a Suppresses Proliferation, Migration, and Invasion of Glioma Cells by Targeting Leucine-Rich Repeat-Containing G Protein-Coupled Receptor 5. Oncology Research, 25(8), 1317-1327.

+ Open protocol

+ Expand

Silencing DANCR gene via siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

The scrambled RNA sequence and DANCR-targeting siRNAs were obtained from GenePharma Co., Ltd. (Shanghai, China). The scrambled RNA sequence and DANCR-targeting siRNA sequences were as follows: si-NC: 5ʹ-UUCUCCGAACGUGUCACGU-3ʹ; si-DANCR-1: 5ʹ-CTACAGGCACAAGCCATTG-3ʹ; si-DANCR-2: 5ʹ-GCGTACTAACTTGTAGCAA-3ʹ; and si-DANCR-3: 5ʹ-GCUGGUAUUUCAAUUGACU-3ʹ. miR-216a mimics were obtained from GenePharma Co., Ltd. (Shanghai, China). Further, 2×10⁴ cells were added into 6-well plates the day before miRNA or siRNA transfection. Next, 100 nM of the miRNAs or siRNAs were transfected into the cells using Lipofectamine 2000 reagent (Invitrogen), according to the manufacturer’s instructions. A scrambled sequence was used as the negative control (NC). The transfection efficiency of the miRNAs or siRNAs was determined by quantitative reverse transcription PCR (qRT-PCR).

Wang W., Li Y., Ma Q., Yan H, & Su W. (2019). Differentiation antagonizing non-protein coding RNA modulates the proliferation, migration, and angiogenesis of glioma cells by targeting the miR-216a/LGR5 axis and the PI3K/AKT signaling pathway. OncoTargets and therapy, 12, 2439-2449.

+ Open protocol

+ Expand

Regulation of HUVEC Senescence by miR-216a

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary human umbilical vein endothelial cells (HUVECs) were cultured in endothelial cell medium (ScienCell, San Diego, CA, USA) containing 5% fetal bovine serum and 1% penicillin/streptomycin, and the replicative senescence model was established. Population-doubling levels (PDLs) were calculated during the passages according to an equation reported previously (1), in which Ch is the number of cells at harvest and Cs is the number of cells seeded [14 (link)]. Consequently, PDL8 and PDL44 HUVECs were defined as young and aging cells, respectively.

\begin{matrix} PD = \log_{2} (\frac{Ch}{Cs}) . \end{matrix}

To explore the regulatory role of miR-216a in target gene expression, PDL8 HUVECs were transfected with 100 nM miR-216a mimics or miR-216a inhibitor (GenePharma, Suzhou, China) using the lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) and harvested at 48 h posttransfection. To determine the effects of Smad7 on endothelial cells, Smad7 was silenced via transfection of 40 nM small interfere RNAs (siRNAs) (Invitrogen, Carlsbad, CA, USA). The following siRNA of Smad7 was used: sense 5′ CAGCGGCCCAAUGACCACGAGUUUA 3′, and antisense 5′ UAAACUCGUGGUCAUUGGGCCGCUG 3′.

Yang S., Chen Y., Mi X., Zhang S., Yang Y., Hui R, & Zhang W. (2020). MicroRNA-216a Promotes Endothelial Inflammation by Smad7/IκBα Pathway in Atherosclerosis. Disease Markers, 2020, 8864322.

+ Open protocol

+ Expand

MicroRNA-216a Modulation in MCAO Model

Check if the same lab product or an alternative is used in the 5 most similar protocols

For miRNA treatment, the mice were anesthetized with chloral hydrate (10%) and then placed in the stereotactic apparatus (anteroposterior 0.8 mm, mediolateral 1.5 mm, depth 3.5 mm; series 68001, RWD Life Science Co., Ltd.). After anesthesia, the mice were subjected to the injection of miR-216a mimics (7 ml of 100 mM, purchased from Gene Pharma) into the left-brain lateral ventricle for 20 minutes in a total volume of 7 ml, 10 minutes after MCAO. The injection was considered successful only when cerebral blood flow dropped to the baseline level (before occlusion) and was maintained for at least 20 minutes during injection. To confirm the overexpression of miR-424, cortical tissue was harvested from each cerebral hemisphere 2 mm around the site of injection and processed for realtime qRT-PCR. After 24 hours of reperfusion, all mice were then used to conduct neurological deficit assessment.

Tian Y.S., Zhong D., Liu Q.Q., Zhao X.L., Sun H.X., Jin J., Wang H.N, & Li G.Z. (2019). Upregulation of miR-216a exerts neuroprotective effects against ischemic injury through negatively regulating JAK2/STAT3-involved apoptosis and inflammatory pathways. Journal of neurosurgery, 130(3).

+ Open protocol

+ Expand

miR-216a Regulation of JAK2 in PCN Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCN cells were first plated in 96-well or 6-well plates, followed by mixing with lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. When cells were 70% confluent, they were transfected with miR-216a mimics (100 nM, GenePharma), miR-NC (50 nM, Gene-Pharma), and JAK2 short-interfering RNA (siJAK2; 50 nM, GenePharma) at the indicated time.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!