The cDNA was synthesized according to the protocol of FastQuant RT kit (Tiangen Biotech, Beijing, China). Adult tissues were isolated from medaka sh that were killed by decapitation after anesthesia with MS-222 (Sigma-Aldrich). Total RNA from adult tissues and embryos were extracted by Ultrapure RNA kit (CoWin Biosciences, Beijing, China) as the protocol provided by the manufacturer. The cDNA was synthesized according to the protocol of FastQuant RT kit (Tiangen Biotech, Beijing, China).
Fastquant rt kit
Manufactured by Tiangen Biotech
Sourced in China, United States, Germany
The FastQuant RT Kit is a laboratory equipment product designed for reverse transcription of RNA samples. It provides the necessary components to convert RNA into complementary DNA (cDNA) for subsequent analysis or applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (173 mentions)
Trizol, by Thermo Fisher Scientific (46 mentions)
Superreal premix plus, by Tiangen Biotech (41 mentions)
Trizol reagent, by Tiangen Biotech (31 mentions)
Superreal premix plus sybr green, by Tiangen Biotech (31 mentions)
Rnasimple total rna kit, by Tiangen Biotech (26 mentions)
Rnaprep pure plant kit, by Tiangen Biotech (23 mentions)
Rnaprep pure cell bacteria kit, by Tiangen Biotech (20 mentions)
Superreal premix plus kit, by Tiangen Biotech (19 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (19 mentions)
Sybr premix ex taq, by Takara Bio (15 mentions)
Lightcycler 96, by Roche (15 mentions)
Mircute mirna isolation kit, by Tiangen Biotech (14 mentions)
Sybr premix ex taq kit, by Takara Bio (14 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (14 mentions)
Mircute mirna first strand cdna synthesis kit, by Tiangen Biotech (12 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (12 mentions)
Mircute mirna qpcr detection kit, by Tiangen Biotech (11 mentions)
Applied biosystems quantstudio 3, by Thermo Fisher Scientific (11 mentions)
Trizol reagent, by Merck Group (10 mentions)
638 protocols using fastquant rt kit
1
Medaka Transcriptome Sample Preparation
2
Medaka Transcriptome Sample Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA was synthesized according to the protocol of FastQuant RT kit (Tiangen Biotech, Beijing, China). Adult tissues were isolated from medaka sh that were killed by decapitation after anesthesia with MS-222 (Sigma-Aldrich). Total RNA from adult tissues and embryos were extracted by Ultrapure RNA kit (CoWin Biosciences, Beijing, China) as the protocol provided by the manufacturer. The cDNA was synthesized according to the protocol of FastQuant RT kit (Tiangen Biotech, Beijing, China).
3
Cassava RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We isolated total RNA from tissues of cassava using an RNAprep Pure Plant Kit (TIANGEN, Beijing, China), and we synthesized cDNA with FastQuant RT Kits (TIANGEN). We performed gene expression analysis in cassava by qPCR with gene‐specific primers (Data S4 ). All qPCR reactions were carried out in triplicate. To evaluate quantity of the amplified qPCR products, we used the comparative ΔΔCT method.
4
Quantifying Cx43 Expression in LX-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from LX-2 cells after MgIG treatment using RNAiso Plus (Takara, Dalian, China) according to the manufacturer’s instructions. Total RNA was reverse transcribed with Fast Quant RT kits (Tiangen Biotech Co., Ltd, Beijing, China) and quantified by SYBR green PCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA). Reactions were run on a 7500 Fast Real-Time PCR System (Applied Biosystems Inc., Waltham, MA, USA). The oligonucleotide sequences of the primers (Sangon Biotech, Shanghai, China) were 5′-CAATCTCTCATGTGCGCTTCT-3′ (sense) and 5′-GGCAACCTTGAGTTCTTCCTCT-3′ (antisense) for Cx43(GJA1) and 5′-CTTCTTTTGCGTCGCCAGCCGA-3′ (sense) and 5′-ACCAGGCGCCCAATACGACCAA-3′ (antisense) for glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
5
Retinal mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three days after intravitreal injection, the total mRNA was extracted from retina homogenates by using the Trizol (Qiagen, Valencia, CA) according to the manufacturer’s instructions. The RNA concentration was determined using a NanoDrop ND-2000 spectrophotometer (Thermo, Waltham, MA). Purified mRNA (1 µg) was used for the first-strand cDNA synthesis using FastQuant RT Kits (KR106, Tiangen, Beijing). The real-time PCR program was as follows: 94 °C for 10 s, followed by 40 cycles of 94 °C for 5 s, 60 °C for 30 s for annealing, and 72 °C for 15 s. Each cDNA template was amplified in triplicate using SYBR Green PCR Master Mix (FP205, Tiangen, Beijing). The PCR reaction was directly monitored using a genetic analyzer (ABI PRISM 7300 System; Applied Biosystems, Waltham, MA). The primers were the following: Thy1.1, F: G G T G G C A G A A G A A G A C A A G G A G, R: G G G C A A G G G A A A G A A G A A T A A A G G; Nefh, F: C C C T C C G T A A G A A G A A A C A C T G, R: C G T A G C G T T C A G C A T A C A T C A C. The expression level of genes was calculated by using the 2−ΔΔCt analysis method.
6
RT-qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using Universal RNA Extraction Kits (Dongsheng Biotech, Guangzhou, China) as described by the manufacturer and reverse transcribed using FastQuant RT kits (Tiangen Biotech, Beijing, China). qRT-PCR proceeded using an ABI StepOne system (ABI) and SuperReal PreMix Kit (Tiangen Biotech, Beijing, China). The relative mRNA expression of GAPDH was calculated using the 2−ΔΔCt method. The forward and reverse (5′ → 3′) primers were as follows:
GAPDH, CATCACCATCTTCCAGGAG and AGGCTGTTGTCATACTTCTC;
SRF, CGAGATGGAGATCGGTATGGT and GGGTCTTCTTACCCGGCTTG;
IDO1, GGAGGACATGCTGCTCAGTT and CTGGCTTGCAGGAATCAGGA.
GAPDH, CATCACCATCTTCCAGGAG and AGGCTGTTGTCATACTTCTC;
SRF, CGAGATGGAGATCGGTATGGT and GGGTCTTCTTACCCGGCTTG;
IDO1, GGAGGACATGCTGCTCAGTT and CTGGCTTGCAGGAATCAGGA.
7
Quantification of Muscle Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from homogenised frozen samples of tibialis anterior muscle using TRIzol reagent (B511311, Sangon Biotech Co, Ltd, Shanghai, China) and 1 µL was reverse transcribed using FastQuant RT kits (KR106, Tiangen Biotech Co, Ltd, Beijing, China). Thereafter, the 2× Taq PCR Master Mix kit (KT201, Tiangen Biotech Co, Ltd) was used for PCR. The PCR electrophoresis bands were photographed using a gel imager and the optical density values of each band were measured using Quantity One software (Bio-Rad Co, Ltd, California, USA). The primer sequences for AChR-ε, AChR-γ, agrin and β-actin were designed and synthesised by Sangon Biotech Co, Ltd and are detailed in table 1 .
8
Quantifying Gene Expression in Arabidopsis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from Arabidopsis leaves using an RNAprep Pure Plant Kit (TIANGEN). cDNA synthesis was performed using FastQuant RT Kits (TIANGEN). Gene expression analysis in Arabidopsis was performed by qPCR with gene-specific primers (Table S1 ). All qPCR reactions were carried out in triplicate, with SYBR® Premix Ex Taq™ II Kit (Takara) on a StepOne™ Real-Time PCR system (Applied Biosystems). The comparative ΔΔCT method was employed to evaluate amplified product quantities in the samples.
9
Arabidopsis Mannitol Stress Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To study the response of transgenic Arabidopsis seedling to mannitol stress, 5-d-old seedling were transferred to 1/2 MS medium containing with 0mM, 100mM, or 200mM D-mannitol grown for 14 days.
Biomass of treating seedlings was measured. The results were showed as percentage, which biomass of control seedlings on 1/2 MS medium containing with 0mM mannitol was indicated as 100%.
Quantitative real-time PCR (qPCR) analysis
Total RNA was from Arabidopsis leaves using an RNAprep Pure Plant Kit (TIANGEN). cDNA synthesis was performed using FastQuant RT Kits (TIANGEN). Gene expression analysis in cassava was performed by qPCR with gene-speci c primers (Table S1). All qPCR reactions were carried out in triplicate, with SYBR® Premix Ex Taq TM II Kit (Takara) on a StepOne TM Real-Time PCR system (Applied Biosystems). The comparative ΔΔCT method was employed to evaluate amplified product quantities in the samples.
Biomass of treating seedlings was measured. The results were showed as percentage, which biomass of control seedlings on 1/2 MS medium containing with 0mM mannitol was indicated as 100%.
Quantitative real-time PCR (qPCR) analysis
Total RNA was from Arabidopsis leaves using an RNAprep Pure Plant Kit (TIANGEN). cDNA synthesis was performed using FastQuant RT Kits (TIANGEN). Gene expression analysis in cassava was performed by qPCR with gene-speci c primers (Table S1). All qPCR reactions were carried out in triplicate, with SYBR® Premix Ex Taq TM II Kit (Takara) on a StepOne TM Real-Time PCR system (Applied Biosystems). The comparative ΔΔCT method was employed to evaluate amplified product quantities in the samples.
10
Total RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent and retrotranscribed after DNase I (Roche, Switzerland) treatment using a FastQuant RT Kit (TIANGEN, P.R. China). Real-time PCR was performed for 45 cycles with SYBR Green PCR Master Mix (TaKaRa, Japan) and processed on CFX 96 system (Bio-Rad, Hercules, CA, USA) as previous described17 (link). Cycle conditions were as follows: initial denaturation at 95°C for 15 min followed by 44 cycles of denaturation at 95°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 30 s, and plate reading. After the cycles, a dissociation curve was generated from 55°C to 95°C with readings every 0.5°C. Reactions were run in triplicate for each sample. Threshold cycles (Ct) for each tested gene were normalized to the housekeeping β-actin gene value (ΔCt), and every experimental sample was referred to its control (ΔΔCt). Fold change values were expressed as 2−ΔΔCt.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!