Gotaq g2 hot start green master mix kit

Genomic DNA from bat spleen samples was subjected to PCR using NIRV universal primers directed against conserved regions of NIRVs found in marsupials, rodents, and bats (NIRVfw: aggtggagcctgtcttgaaa and NIRVrv: atcacatcctgatggctggt). PCR was performed using the GoTaq G2 Hot Start Green Master Mix kit (Promega) under the following thermal cycling conditions: 95 °C for 2 min followed by 37 cycles at 95 °C for 30 s, 43 °C for 1 min and 72 °C for 30 s, and a final step of 72 °C for 5 min. Amplification products of the expected size of 276 bp were purified using QIAquick PCR Purification kit or QIAquick Gel Extraction kit (QIAGEN, Hilden, Germany) according to manufacturer’s instructions and then sequenced using the Sanger method. Identification of open-reading frames (ORFs) and translated products was done using Expasy (https://www.expasy.org/, accessed on 18 February 2021). Multiple protein sequence analysis was carried out via Clustal Omega at EMBL-EBI. Alignment visualization was done using MView (https://desmid.github.io/mview/, accessed on 18 February 2021).

Genomic DNA from a select number of Drosophila KK transgenic RNAi library stocks was isolated following a protocol available at the VDRC (www.vdrc.at). The presence or absence of the KK RNAi transgene at the 40D insertion site on the second chromosome was determined by multiplex PCR using the following primers:
40D primer (C_Genomic_F): 5′-GCCCACTGTCAGCTCTCAAC-3′
pKC26_R: 5′-TGTAAAACGACGGCCAGT-3′
pKC43_R: 5′-TCGCTCGTTGCAGAATAGTCC-3′
PCR amplification was performed using GoTaq G2 Hot Start Green Master Mix kit (Promega) in a 25 µL standard reaction mix and the following program: initial denaturation at 95° for 2 min, followed by 33 cycles with denaturation at 95° for 15 sec, annealing at 58° for 15 sec and extension at 72° for 90 sec. One final extension reaction was carried out at 72° for 10 min. Reactions were stored at -20° prior to gel loading. PCR using these primers generate an approximately 450 bp product in case of a transgene insertion or a 1050 bp product in case of no transgene insertion site at 40D.