Miniseq sequencer

To determine the precise genomic location of TnJM1 insertions, the genomic DNA of the clones of interest was pooled per 5 and analyzed by whole genome sequencing. For this, genomic DNA was isolated from overnight LB cultures using the GeneJet Genomic DNA purification kit (Thermo Fisher Scientific), after which 150 bp paired-end libraries were prepared using the Nextera XT DNA Library Preparation Kit (Illumina) or Nextera DNA Flex Library Preparation Kit (Illumina). Sequencing was performed with an Illumina NovaSeq 6000 sequencer (Illumina) or Miniseq sequencer (Illumina), and single reads were analyzed using Geneious to determine TnJM1 insertion loci. All genomic transposition sites were confirmed by PCR using primers upstream and downstream of the suspected region of interest (Table S3) and by subsequent sequencing of this locus (Macrogen). Sequences of the TnJM1 insertions sites for the different isolated mutants are listed in supplemental file 1.

Primary, human AML peripheral blood and bone marrow aspirate samples (721214) were thawed from cryopreserved stocks and labeled with CD99 FITC-conjugated antibody (clone 3B2/TA8, ThermoFisher) in staining buffer (2% fetal bovine serum, 0.25 mM EDTA in PBS) for 30 min at 4 °C followed by viability dye for 5 min at room temperature (SytoxBlue, ThermoFisher). Live cells were analyzed using a Sony SY3200 Synergy flow cytometer, gated for sorting on the top 15% and bottom 15% with respect to CD99 expression, and collected for analysis. Genomic DNA was prepared with the QIAmp DNA micro kit (Qiagen) according to the manufacturer’s protocol. Targeted sequencing was achieved by generating amplicons to capture mutations at DNMT3A^R882 (forward: CGCAAAATACTCCTTCAGCG, reverse: TTTCTCCCCCAGGGTATTTG) and GATA2^R361 (forward: TGTGCAGCTTGTAGTAGAGG, reverse: TGAGATTTAGCCCTCCTTGAC). Amplicons were indexed and spiked into 2x150 dual indexed runs on an Illumina MiniSeq sequencer. FastQC⁷¹ was used for quality analysis of sequenced reads (FASTQ files). Reads were checked for contamination, adapter sequences and base quality, then aligned against human reference sequence (GRCh37) using bwa (version 0.7.15)^{72 (link)}. Varscan2^{57 (link)} was used to identify SNVs and calculate variant allele frequencies (VAF).

Genomic DNA was extracted from 2 ml of peripheral blood using a DNA extraction kit (GenMagBio, Amherst, NY, United States). NanoDrop One (Thermo Fisher Scientific, Waltham, MA, United States) was used to measure DNA concentration and purity. A multiplex PCR kit was designed to cover the entire coding region of GJB2, SLC26A4, and MT-RNR1, as an updated version of the kit developed in a previous study (Tian et al., 2021 (link)). Multiplex PCR assay does not include detection of the GBJ2 exon 1. The resulting libraries were sequenced on an Illumina MiniSeq sequencer (Illumina, San Diego, CA, United States) in 150-bp paired-end mode. Bioinformatics analysis was performed in the bcbio-nextgen framework (https://github.com/bcbio/bcbio-nextgen). Reads trimming, genome aligning, variant annotation, filtering, and interpretation were carried out as described previously (Tian et al., 2021 (link)).

The whole-genome sequencing of HRV, IAV, and hMPV was performed using samples with low Ct values (<35). RNA samples were randomly amplified using a REPLI g WTA Single Cell Kit (Qiagen, Hilden, Germany). Libraries were prepared using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA) in combination with NEBNEXT Multiplex Oligos for Illumina (Dual Index Primers Set 1 and Set 2) (New England Biolabs) according to the manufacturer’s instructions. After the libraries were quantified using the NEBNext Library Quant Kit (New England Biolabs), sequencing was performed using the Miniseq High Output Kit on a Miniseq sequencer (Illumina, San Diego, CA, USA). The read data were trimmed and mapped to a reference sequence using CLC Genomics Workbench software (Qiagen). Consensus sequences were extracted as complete or nearly complete.

Access to OCCRA (RRID : SCR_007834) (Thermo Fisher Scientific, Waltham, MA) was granted via an early access program. The DNA assay was utilized, which calls SNVs from hotspots of 86 genes and full exons of 44 genes, and CNVs from 28 genes. DNA was extracted from macro-dissected tissue using ReliaPrep FFPE DNA extraction kit (Promega, Madison, WI, USA). OCCRA primers and AmpliSeq Library Kit Plus (Illumina, San Diego, California, USA) were used for library preparation. The prepared libraries were sequenced using a MiniSeq sequencer (Illumina). Base calling and mapping to a reference genome (hg19) was performed using the BaseSpace Informatics suite (Illumina). SNV variant calling was performed with the DNA amplicon application (Illumina, version 2.1.1) and CNV calling was performed with the OncoCNV caller application (Illumina, version 1.2.0). All VCF files were loaded into variant interpreter (version 2.7.0.412) for interpretation. Criteria for selecting somatic SNV candidates were: >100 minimum coverage reads, 10% minimum allele frequency, cosmic reported variant, and <1% prevalence in the 1000 Genome Population Database.

The sequences of consecutively isolated strains from Patient 2 were analyzed. Genomic DNA from S. epidermidis strains 180411 and 181231 was extracted using a DNeasy UltraClean Microbial kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Sequencing libraries were prepared using Illumina Nextera DNA Flex, and sequenced on an Illumina MiniSeq sequencer (Illumina, Inc., San Diego, California, USA). Analysis of the sequencing data was performed on the Pathosystems Resource Integration Center (PATRIC) platform [23 (link)]. After quality control and trimming of the raw reads, the genomes were assembled de novo using SPAdes 3.8 software, and submitted to the National Center for Biotechnology Information (NCBI) for functional annotation in the Prokaryotic Genome Annotation Pipeline (PGAP) and publication in GenBank (accession numbers VANN00000000 and VANO00000000). The genomes were compared using progressiveMauve [24 (link)], and by performing single-nucleotide polymorphism (SNP) analysis using Snippy v4.3.8 software with S. epidermidis 180411 as the reference strain.

THP‐1 MIEP GFP cells were stably transduced with Cas9. CRISPR sgRNA library lentivirus was produced as indicated above and titrated on THP‐1 MIEP GFP CAS9 cells. For targeted CRISPR screening 20 million THP‐1 MIEP GFP CAS9 were transduced at 35% infectivity with the epigenetic sgRNA library, sorted at day 8. 1.5% (300 000 cells) of the brightest BFP+/GFP^high phenotype and genomic DNA was extracted from sorted cells alongside an age‐matched library sample.
Integrated sgRNA was amplified via two rounds of PCR using primers as indicated in Supporting Information materials, starting with 50 μg of gDNA for the library and sorted sample. PCR products were purified using AMPure XP beads (Agencourt), quantified on a DNA‐1000 chip (Agilent) and sequenced on a Miniseq sequencer (Illumina) running MiniSeq Control Software v1.1.8 (Illumina). Reads were aligned to library sequences using Bowtie,
¹ (link) allowing read alignment to a maximum of two sgRNA and one mismatch. sgRNA abundance in the sorted sample was compared against a screen‐internal library sample and sgRNA enrichment was computed using the MAGeCK algorithm under default settings.
² Hits with a MAGeCK score <10⁻⁵. Full datasets, including read counts, MAGeCK analysis, and selected hits, are available in Supporting Information Data.