Genomic DNA from the cultured cells and specimens was isolated using a Universal Genomic DNA Extraction Kit Ver3.0 (Takara Bio Inc.). The concentration and purity of DNA were controlled by ultraviolet-visible spectrophotometry (1.82O and stored at −80°C. The genomic DNA of each specimen was treated with bisulfite modification and the protocol was as per Herman et al.25 (link) Genomic DNA (2 μg) was treated with sodium bisulfite (Sigma-Aldrich). In brief, genomic DNA was denatured in 3 mol/L NaOH for 15 minutes at 37°C. Cytosines were sulfonated in 3.6 mol/L sodium bisulfite and 1 mmol/L hydroquinone (Sigma-Aldrich) for 16 hours at 55°C. The modified DNA samples were desalted using a DNA cleanup system (Promega Corporation, Fitchburg, WI, USA). The modified DNA samples were dissolved with ddH2O and stored at −80°C.
Sodium bisulfite
Manufactured by Merck Group
Sourced in United States, Germany, Spain, Israel, United Kingdom
Sodium bisulfite is a chemical compound that is commonly used in various laboratory applications. It is a white, crystalline solid that is soluble in water. Sodium bisulfite's core function is to act as a reducing agent, which means it can be used to remove oxygen or other oxidizing agents from solutions. This property makes it useful in various scientific and industrial processes.
Automatically generated - may contain errors
Lab products found in correlation
Hydroquinone, by Merck Group (11 mentions)
Methanol, by Merck Group (8 mentions)
Sodium hydroxide (naoh), by Merck Group (6 mentions)
Folin ciocalteu reagent, by Merck Group (5 mentions)
L arginine, by Merck Group (5 mentions)
Acetic acid, by Merck Group (5 mentions)
Carbidopa, by Teva Pharmaceuticals (4 mentions)
Sodium carbonate, by Merck Group (4 mentions)
Caffeic acid, by Merck Group (4 mentions)
Sodium chloride (nacl), by Thermo Fisher Scientific (4 mentions)
Sulfuric acid, by Thermo Fisher Scientific (4 mentions)
Hydrochloric acid (hcl), by Merck Group (4 mentions)
Hydrochloric acid (hcl), by Thermo Fisher Scientific (3 mentions)
Sodium dodecyl sulfate (sds), by Merck Group (3 mentions)
Hydrogen peroxide, by Merck Group (3 mentions)
Acetone, by Merck Group (3 mentions)
Gallic acid, by Merck Group (3 mentions)
Quercetin, by Merck Group (3 mentions)
Hydroxyquinone, by Merck Group (3 mentions)
Pmd18 t vector system, by Takara Bio (3 mentions)
73 protocols using sodium bisulfite
1
Genomic DNA Bisulfite Modification
2
Bisulfite Sequencing of Placental DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA samples was extracted from normal and PE placentas, and purified by using DNAzol (Invitrogen). Purified DNA samples were further treated with sodium bisulfite (Sigma, Phoenix, USA), and then analyzed by bisulfite-sequencing PCR (BSP) as previously described [23] . The base sequence of LN-α5 is:
TGGGCTGGGAGGAGCTGGTGGGCGCTCTGGGGGCCAGGGCGTCGTGGGGAGCGCTAGGGTCCCACCCGGGA CCCGGAGCTACGACCTGGGCTGGGGGCCCGGCGGCGCCGTCGTCCCACGGCCTGGCCCGAGGCCAGCAGGTG CCCCTTCCGGGAGGCGGCCGGGCCGGGGTCCGAAGGGTTAAGGCCGCCCGGCCGCCCCTCCCCCTCCTCTCT CCTTCCCCCCCCCACCCCGCCTCCCCGGACCTCTCCCCGGGGCTCGGGGCTCGGGCGCTCGGGCGGGCCGGG GCGGGGCCTGACGTCCGCGGGCGGAGCGAGCCCTGCCGGCCGCCTGGCTTCAGACCCGCCGGGCT.
The methylation-specific primers were InF: 5'-TGGGTTGGGAGGAGTTGGT and InR: 5'-AACCCRACRAATCTAAAACCAA. All analyses were conducted on the CpG site and region levels. Regional analysis was performed on predefined genomic regions (5 kb tiles, genes, promoters and CpG islands).
TGGGCTGGGAGGAGCTGGTGGGCGCTCTGGGGGCCAGGGCGTCGTGGGGAGCGCTAGGGTCCCACCCGGGA CCCGGAGCTACGACCTGGGCTGGGGGCCCGGCGGCGCCGTCGTCCCACGGCCTGGCCCGAGGCCAGCAGGTG CCCCTTCCGGGAGGCGGCCGGGCCGGGGTCCGAAGGGTTAAGGCCGCCCGGCCGCCCCTCCCCCTCCTCTCT CCTTCCCCCCCCCACCCCGCCTCCCCGGACCTCTCCCCGGGGCTCGGGGCTCGGGCGCTCGGGCGGGCCGGG GCGGGGCCTGACGTCCGCGGGCGGAGCGAGCCCTGCCGGCCGCCTGGCTTCAGACCCGCCGGGCT.
The methylation-specific primers were InF: 5'-TGGGTTGGGAGGAGTTGGT and InR: 5'-AACCCRACRAATCTAAAACCAA. All analyses were conducted on the CpG site and region levels. Regional analysis was performed on predefined genomic regions (5 kb tiles, genes, promoters and CpG islands).
3
Carbidopa-Arginine Solution Formulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 4
A 4% Carbidopa solution/formulation was prepared as follows:
Carbidopa [Teva] and L-arginine [Merck] (molar ratio 1:1.1) were weighed in a suitable container and water was added to obtain 89% of the total projected batch weight. N-methyl 2-pyrrolidone [Pharmasolve, ISP] was added to obtain the final concentration of 3.5% (w/w). Sodium bisulfite [Sigma] solution was prepared and added to obtain a final concentration of 0.05% (v/w). The mixture was heated to 65±10° C. with constant stirring. When the solids were completely dissolved, heating was stopped and the preparation was allowed to cool down to room temperature. The solution was filtered using a sterile 0.22 μM PVDF membrane.
Carbidopa-Arginine solutions/formulations, 2 and 3%, were prepared by diluting the 4% Carbidopa-arginine solution/formulation with respective amount of double distilled water (DDW) containing 3.5% N-MP, with or without 0.05% Sodium bisulfite.
4
Characterization of Analytical-Grade Sulfites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Potassium metabisulfite (Synth), sodium bisulfite (Sigma-Aldrich), sodium metabisulfite (Reagen) and sodium sulfite (Nuclear) of analytical grade were all commercially obtained in powder form and used as received. The samples were not crushed or sieved to avoid creation of defects by mechanical action.
5
Bisulfite Treatment and CMV Promoter Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted and treated with sodium bisulfite (Sigma, Missouri, United States) as previously described [48 (link)-50 (link)]. The CMV promoter region was amplified with three primer sets. Universal primers were used to amplify the total DNA (both methylated and unmethylated DNA). Unmethylated DNA-specific and methylated DNA-specific primers (Additional file 2 : Table S1) were used to amplify unmethylated and methylated CMV promoter sequences, respectively.
6
DNA Bisulfite Conversion and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A mixture of 4 μg genomic DNA, 10 μg salmon sperm DNA and 0.3 M NaOH was collected. Water was used to top up the final volume to 20 μl. The mixture was incubated at 50 °C for 20 min to denature the DNA. Next, the mixture was transferred into 500 μl of solution containing 3 M sodium bisulfite (Sigma, Saint Louis, MO) and 10 mM hydroquinone (Sigma, Saint Louis, MO) and incubated at 70 °C for 4 h. DNA was then purified using the Wizard DNA Clean-Up System (Promega Corp., Madison, WI). After purification, DNA was followed by ethanol precipitation, dry and dissovled in distilled water.
7
Synthesis of Polymeric Materials
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methyl Methacrylate (MMA) and Glycidyl methacrylate (GMA) were purchased from ACROS (USA), and Potassium persulfate and sodium bisulfite were obtained from Sigma Chem. Co. (St. Louis, MO, USA), Ethanol absolute perused from Adwic, Egypt, and finally, MB from Aldrich, Germany was perused. Potassium dichromate (K2Cr2O7), minimum assay 99%, was supplied by Sigma Aldrich, Germany. Potassium permanganate (KMnO4), a minimum assay of 99%, was supplied by Sigma Aldrich, Darmstadt, Germany.
8
Analytical Reagents for Compound Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The L-(+)-tartaric acid (99%), ethyl acetate (99.9%), methanol (99.8%), acetonitrile (99.8%), acetic acid (99.7%), Folin–Ciocalteu reagent, and sodium bisulfite were obtained from Sigma-Aldrich, Madrid, Spain. Ethanol was purchased from AGA® (96%), Prior Velho, Portugal and HCl 37% from Fluka®, College Park, MD, USA. All standard compounds used in the quantification of volatiles presented high purity (≥95%) as described elsewhere [19 (link)] and were purchased from Sigma-Aldrich, Inc. (Steinheim, Germany).
9
Carbidopa-Arginine Salt Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 1
Carbidopa-Arginine salt was prepared as follows:
Carbidopa (CD) [Teva Pharmaceuticals Ltd., Israel] was weighed in a suitable container with L-arginine [Merck] (at molar ratio of 1:1) and a 0.2% sodium bisulfite [Sigma] solution in water was added to obtain a final concentration of 4.0% Carbidopa. The mixture was heated to 65±10° C. with constant stirring. When the solids were completely dissolved, solution was filtered using 0.45 μM nylon membrane. The filtered solution was immediately frozen in dry ice and subsequently subjected to lyophilzation. Off-white crystals were obtained and subsequently subjected to MS analysis. The MS analytical results clearly showed Carbidopa and L-arginine ions and fragments (
10
Preparation of Carbidopa-Arginine Formulations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 2
A 4% Carbidopa solution/formulation was prepared as follows:
Carbidopa [Assia Ltd., Israel] was weighed in a suitable container and water was then added to obtain 73% of the total projected batch weight. Mixture was stilled at room temperature for 20 minutes. L-Arginine [Sigma] was added to the mixture to obtain a molar ratio 1:1 with carbidopa. The mixture was heated to 65±10° C. with constant stirring. When the solids were completely dissolved, N-methyl 2-pyrrolidone [Pharmasolve, ISP] was added to obtain the final concentration of 10% (w/w). Sodium bisulfite [Sigma] solution was prepared and added to obtain a final concentration of 1% (v/w). Stirring was continued for additional 30 minutes at 65±3° C. Thereafter, PVP [Polyvinylpyrrolidone, Sigma] solution was prepared and added to obtain a final concentration of 1% (v/w). Stirring was continued for 30 minutes at 65±3° C. Heating was stopped and the preparation was allowed to cool down to room temperature. Solution was filtered using a sterile 0.22 μM PVDF membrane.
Carbidopa-Arginine solutions/formulations, 2 and 3%, were prepared by diluting the 4% carbidopa-arginine solution/formulation with the respective amount of double distilled water (DDW).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!