Blasticidin s hcl

Manufactured by Thermo Fisher Scientific

Sourced in United States, Sweden, Canada

Blasticidin S HCl is a broad-spectrum antibiotic that inhibits protein synthesis in both eukaryotic and prokaryotic cells. It is commonly used as a selection marker in cell culture-based experiments.

Automatically generated - may contain errors

Lab products found in correlation

104 protocols using blasticidin s hcl

Lentiviral Transduction of Ba/F3 and U87MG Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ba/F3 cells (4.0 × 10⁴ cells) were infected with 20 µL of viral supernatant supplemented with 8-µg/mL polybrene by centrifuging for 30 minutes at 1,000 rpm. Cells were placed in a 37°C incubator overnight. Then, 100 µL cells and supernatant were added to 900 µL of RPMI1640 medium (Life Technologies) supplemented with 10% FBS, 1% l-glutamine, and 15 µg/mL blasticidin S HCl (Life Technologies). Cells were placed in a 37°C incubator and monitored for outgrowth over a 2-week period.
U87MG cells (1.0 × 10⁶ cells) were infected with 2 mL of viral supernatant supplemented with 8-µg/mL polybrene in T150 flasks. Cells were placed in a 37°C incubator overnight. After 24 hours, cells were given a media change and were placed in a 37°C incubator overnight. Cells were then selected in presence of 25 µg/mL blasticidin S HCl (Life Technologies) and monitored for outgrowth.

Ishiyama N., O'Connor M., Salomatov A., Romashko D., Thakur S., Mentes A., Hopkins J.F., Frampton G.M., Albacker L.A., Kohlmann A., Roberts C, & Buck E. (2022). Computational and Functional Analyses of HER2 Mutations Reveal Allosteric Activation Mechanisms and Altered Pharmacologic Effects. Cancer Research, 83(9), 1531-1542.

+ Open protocol

+ Expand

Overexpression and knockdown studies of SLFN12 and ZEB1

Check if the same lab product or an alternative is used in the 5 most similar protocols

70–80% confluent MDA-MB-231, BT549, Hs578T cells in six-well plates were transduced at 1000–4000 particles/cell with AdCMV control, AdSLFN12 or AdZEB1 for twenty-four hours in 1ml complete
DMEM (for MDA-MB-231, Hs578T cells) or RPMI1640 (for BT549 cells). Twenty-four hours after infection, the medium was changed, and cells were harvested at 72 or 96 hours.
For lentivirus studies, 500ul viral HEK-239T supernatant was added to 70–80% confluent cells with 1.5ml Opti-MEM medium containing 1.5ul polybrene transfection reagent (Millipore-Sigma, Burlington, MA, #TR-1003-G) at 10ug/ml. Two days later, media was replaced with fresh DMEM media with 10% fetal bovine serum and 10μM Blasticidin-s HCL (Gibco, Waltham, MA, #A11139–03) and cells were cultured for three weeks for selection.
For siRNA studies, 300, 000 cells/well were plated into six-well plates before transfection with non-targeting siNT5 (100nM) (Dharmacon, D-001210–05-20) or SMARTpool siSLFN12 (100nM) (Dharmacon, L-018142–02-0020) using Lipofectamine RNAiMAX (Thermo Fisher, Waltham, MA, #13778150) transfection reagent (7.5ul/well) formulated in Opti-MEM medium. The mixture was added gradually into 1 ml of complete medium/well. Medium was changed after eight hours and experiments terminated after 72 hours.

Al-Marsoummi S., Vomhof-DeKrey E, & Basson M.D. (2019). Schlafen12 Reduces the Aggressiveness of Triple Negative Breast Cancer through Post-Transcriptional Regulation of ZEB1 That Drives Stem Cell Differentiation. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 53(6), 999-1014.

+ Open protocol

+ Expand

CRISPR-based reporter assay for target cleavage

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Target sites were cloned into a pRGS backbone (PNA Bio Inc.) containing an RFP reporter and two out-of-frame GFP reporters, as previously described^{63 (link)}. gRNA was annealed as described above. HeLa-Cas9 cells (previously authenticated and shown to be free of mycoplasma)^{11 (link)} were cultured in high-glucose DMEM media with pyruvate (Gibco) supplemented with 10% FBS/1× pen-strep/1× glutamine (Gibco) and 5 µg mL⁻¹ Blasticidin S HCl (Gibco) at 37 °C in 5% CO₂. Transfection of the HeLa-Cas9 cells was performed using DharmaFECT Duo (Dharmacon), according to manufacturer instructions for the CRISPR system. The degree of target sequence cleavage was calculated based on the %GFP + /%RFP + cells using an Attune NxT Flow Cytometer (Invitrogen).

Krysler A.R., Cromwell C.R., Tu T., Jovel J, & Hubbard B.P. (2022). Guide RNAs containing universal bases enable Cas9/Cas12a recognition of polymorphic sequences. Nature Communications, 13, 1617.

+ Open protocol

+ Expand

Maintenance of Cell Lines for Research

Check if the same lab product or an alternative is used in the 5 most similar protocols

OPM-1, KMS-11, BJAB, SUDHL10, U2932, HLY1, and HT cells were maintained in RPMI-1640 media containing 10% fetal bovine serum (FBS). HEK293T cells were maintained in Dulbecco’s modified Eagle’s media (DMEM) containing 10% FBS. HEK293T cells were purchased from ATCC. B-cell cancer cell lines were kindly provided by Dr. Laura Pasqualucci, Dr. Michele Pagano and Dr. Yibin Yang. Cell line authentication was not performed as cells were not listed in the commonly misidentified category. All cell lines were free of mycoplasma contamination (MycoAlert kit, Lonza). Cell lines were passaged for less than 6 months after receipt or resuscitation. The following drugs were used: MG132 (Peptides International, #IZL-3175-v; 10 μM final concentration), MLN4924 (EMD Millipore, #505477; 5 μM final concentration), cycloheximide (Sigma-Aldrich, #C7698; 20 mg/mL final concentration), Doxycycline hyclate (Sigma-Aldrich, #D9891; 1 ng/mL or 1 mg/mL final concentration), and IACS-010759 (Selleck Chemicals, #S8731), puromycin (Sigma-Aldrich, 0.5–1 μg/ml final concentration), hygromycin B (EMD Millipore, #400052, 100–200 μg/mL), zeocin (100–250 μg/mL), and blasticidin S HCl (Gibco, #R21001, 3–15 μg/mL). CRISPR-derived HEK293T FBXW7^–/– clones were selected using single cell cloning in 96-well plates.

Saffie R., Zhou N., Rolland D., Önder Ö., Basrur V., Campbell S., Wellen K.E., Elenitoba-Johnson K.S., Capell B.C, & Busino L. (2020). FBXW7 triggers degradation of KMT2D to favor growth of diffuse large B-cell lymphoma cells. Cancer research, 80(12), 2498-2511.

+ Open protocol

+ Expand

Establishment of Cell Lines for SARS-CoV-2 Research

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were maintained in humidified incubators at 34 or 37°C and 5% CO₂ in the indicated media. BSRT7/5, Vero CCL81, Vero E6, Vero E6-TMPRSS2, A549, Caco-2, Caco-2 BBe1, Calu-3, Huh7.5.1, HepG2, H1Hela, BHK-21, HEK293, and HEK293T were maintained in DMEM (Corning or VWR) supplemented with glucose, L-glutamine, sodium pyruvate, and 10% fetal bovine serum (FBS). Vero-furin cells (Mukherjee et al., 2016 (link)) also were supplemented with 5 μg/mL of Blasticidin S HCl (GIBCO). MA104 cells were maintained in Medium 199 (GIBCO) containing 10% FBS. HT-29 cells were cultured in complete DMEM/F12 (Thermo Fisher) supplemented with sodium pyruvate, non-essential amino acids, and HEPES (Millipore Sigma). Vero E6-TMPRSS2 cells were generated using a lentivirus vector. Briefly, HEK293T producer cells were transfected with pLX304-TMPRSS2, pCAGGS-VSV-G, and psPAX2, and cell culture supernatants were collected at 48 h and clarified by centrifugation at 1,000 x g for 5 min. The resulting lentivirus was used to infect Vero E6 cells for 24 h, and cells were selected with 40 μg/mL Blasticidin S HCl for 7 days.

Case J.B., Rothlauf P.W., Chen R.E., Liu Z., Zhao H., Kim A.S., Bloyet L.M., Zeng Q., Tahan S., Droit L., Ilagan M.X., Tartell M.A., Amarasinghe G., Henderson J.P., Miersch S., Ustav M., Sidhu S., Virgin H.W., Wang D., Ding S., Corti D., Theel E.S., Fremont D.H., Diamond M.S, & Whelan S.P. (2020). Neutralizing Antibody and Soluble ACE2 Inhibition of a Replication-Competent VSV-SARS-CoV-2 and a Clinical Isolate of SARS-CoV-2. Cell Host & Microbe, 28(3), 475-485.e5.

+ Open protocol

+ Expand

Lentiviral Cas9 Transduction and Selection

Check if the same lab product or an alternative is used in the 5 most similar protocols

lentiCas9-Blast viral particles were purchased from Addgene (#52962) and used to infect U2OS and HeLa cells according to the manufacturer’s protocol. Briefly, on the day of infection, cells were trypsinized, counted, and diluted to a working concentration of 50,000 cells mL⁻¹ in DMEM media supplemented with 10% FBS/1× pen-strep/1× glutamine (Gibco) (DMEM complete) and 10 µg mL⁻¹ polybrene. Viral particles were serially diluted down to 1:500 from the original stock (2.5 × 10⁵ TU mL⁻¹), with 500 µL of each dilution added to the corresponding wells of a 6-well plate. 1 mL of cell suspension was added to each well and incubated at 37 °C and 5% CO₂. 48 h after infection, selection was performed in DMEM-complete media supplemented with 10 µg mL⁻¹ Blasticidin S HCl (Gibco). After selection, cells stably expressing Cas9 were maintained in DMEM-complete media with 5 µg mL⁻¹ Blasticidin S HCl.

Cromwell C.R., Sung K., Park J., Krysler A.R., Jovel J., Kim S.K, & Hubbard B.P. (2018). Incorporation of bridged nucleic acids into CRISPR RNAs improves Cas9 endonuclease specificity. Nature Communications, 9, 1448.

+ Open protocol

+ Expand

Generation of TRIM34 and TRIM5 Knockout THP-1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Clonal knockout lines in THP-1 cells were generated by electroporation of multiplexed small guide RNA (sgRNA) from Gene Knockout Kit v2 (Synthego, Redwood City, CA) against TRIM34 (guide sequences = CTTGCTTAACGTACAAG, CCACAGTCTAGACTCAA, GCAGTGACCAGCATGGG) or TRIM5 (guide sequences = GGUAACUGAUCCGGCACACA, ACUUCUUGUGGUUUGCAGUG, CCUGGUUAAUGUAAAGGAGG). Single cell clonal lines were generated by single cell sorting (TRIM34) or limiting dilution (TRIM5). Knockout efficiency was validated by Interference of CRISPR Edits (ICE) analysis (Synthego) [62 (link)] (Additional file 1:Chromatograms S1, S6–S10).
Pooled knockout lines were generated by transduction of THP-1 cells with lentiviral preps containing guides delivered by pLentiCRISPR-v2. TRIM5 guide sequences = TCACCACACGTTCCTCACAG and GTTGATCATTGTGCACGCCA. NTC guide sequences = GGGCCCGCATAGGATATCGC and TAGACAACCGCGGAGAATGC. Cells were spinoculated in the presence of 20 µg/mL DEAE-Dextran (Pharmacia Fine Chemicals, Uppsala, Sweden, #17-0350-01) and then selected in 10 µg/mL blasticidin S HCl (Gibco #A11139-03). Knockout efficiency was validated by ICE analysis[62 (link)] (Additional file 1: Chromatograms S2–S5).

Twentyman J., Khalifeh A., Felton A.L., Emerman M, & Ohainle M. (2023). Primate TRIM34 is a broadly-acting, TRIM5-dependent lentiviral restriction factor. Retrovirology, 20, 15.

+ Open protocol

+ Expand

Stable Knockdown Cell Lines for ErbB2 and ATP2B2

Check if the same lab product or an alternative is used in the 5 most similar protocols

Stable cell lines expressing shRNA directed against ErbB2 (HER2) and ATP2B2 (PMCA2) [12 (link)] were generated by transducing cells with commercially prepared lenteviruses: HER2 (318–328) from AMSbio or PMCA2 (sc-42598) from Santa Cruz. Cells were cultured in 12-well plates and infected by adding the various shRNA lentiviral particles to the culture for 48 hours as per the manufacturer’s instructions. Stable clones expressing the specific shRNAs were selected using 5μg/ml Blasticidin S HCl (Gibco-life technologies) (HER2), or 5μg/ml of puromycin (Gibco-life technologies) (PMCA2).

Jeong J., Kim W., Kim L.K., VanHouten J, & Wysolmerski J.J. (2017). HER2 signaling regulates HER2 localization and membrane retention. PLoS ONE, 12(4), e0174849.

+ Open protocol

+ Expand

Generation of Stable Myc- and FLAG-tagged Protein Clones in Mouse Embryonic Stem Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

mESCs were maintained on gelatin-coated petri dishes in serum-containing medium (DMEM supplemented with 15% fetal bovine serum, 0.1 mM nonessential amino acids, 0.1 mM β-mercaptoethanol, 50 U/mL penicillin, 50 μg/mL streptomycin, 10³ U/mL leukemia inhibitory factor). Generation of stable clones in mESCs were described previously (Chen et al. 2003 (link); Kim et al. 2013 (link); Veland et al. 2019 (link)). Briefly, plasmids expressing Myc- and FLAG-tagged proteins simultaneously were transfected into Dnmt3a/3b DKO or Dnmt3a/3b/3l TKO mESCs using Lipofectamine 2000 (Invitrogen), then seeded at low density in dishes coated with feeder cells, selected with Blasticidin S HCl (Gibco) for 7 d, and individual clones were picked. Protein expression was analyzed by Western blotting with antibodies (Supplemental Table S3).

Zeng Y., Ren R., Kaur G., Hardikar S., Ying Z., Babcock L., Gupta E., Zhang X., Chen T, & Cheng X. (2020). The inactive Dnmt3b3 isoform preferentially enhances Dnmt3b-mediated DNA methylation. Genes & Development, 34(21-22), 1546-1558.

+ Open protocol

+ Expand

Optimized AHA Metabolic Labeling of Nascent Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples were pulsed for 15 m with DMEM/F-12 w/o L-methionine (US Biological Life Sciences, D9807-05A) differentiation media for optimized AHA labeling. Then, samples were cultured in DMEM/F-12 w/o L-methionine differentiation media with 1 mM AHA (Sigma-Aldrich, 900892; labeling condition) or 0.1 mM L-methionine (Sigma-Aldrich, M5308; control condition) for 1 h. As a negative control, nascent protein synthesis was blocked by addition of 1 μM Blasticidin S HCL (Gibco, A1113903) to AHA-supplemented media. As with EdU labeling, samples were harvested and fixed in 100 μL 4% phosphate-buffered paraformaldehyde for 15 m at RT, permeabilized in 100 μL of saponin-based permeabilization wash for 15 m at RT, and proceeded to Click-iT reaction labeling.

Lu V., Roy I.J., Torres A J.r., Joly J.H., Ahsan F.M., Graham N.A, & Teitell M.A. (2022). Glutamine-dependent signaling controls pluripotent stem cell fate. Developmental cell, 57(5), 610-623.e8.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!