Plasmids of shRNAs targeting RRM2 and scrambled shRNA were purchased from GenePharma (Shanghai, China). The shRNA of RRM2 or scrambled was transfected into U87 or LN-229 cells using lipofectamine 2000 (Invitrogen, California, USA), followed by 40 days of selection with 600 μg/mL of puromycin. The RRM2 shRNAs (shRRM2#1 and shRRM2#2) target the sequences: GGU CCU ACA UUA GUG CCU UTT and GCU GUA CUA UCU GCG AAA UTT, respectively. RRM2 knock-down in these cells was confirmed by Western blot.
Scrambled shrna
Manufactured by GenePharma
Sourced in China
Scrambled shRNA is a laboratory tool used in gene expression studies. It serves as a negative control for RNA interference experiments involving short hairpin RNA (shRNA). Scrambled shRNA lacks specific targeting to any known gene, allowing researchers to distinguish off-target effects from the intended gene knockdown.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Murine il 3, by R&D Systems (1 mentions)
Pcdna3, by Sangon (1 mentions)
Rpmi 1640, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Ba f3, by American Type Culture Collection (1 mentions)
Mhcc97h, by Thermo Fisher Scientific (1 mentions)
Mhcc97l, by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Mhcc 97h, by Keygen Biotech (1 mentions)
Mhcc 97l, by Keygen Biotech (1 mentions)
β mer, by Thermo Fisher Scientific (1 mentions)
Facs arial 3, by BD (1 mentions)
Puromycin, by Solarbio (1 mentions)
Shrna, by GenePharma (1 mentions)
Scrambled shrna, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
7 protocols using scrambled shrna
1
RRM2 Knockdown in Glioma Cells
2
Sirt1 Overexpression and Knockdown in Mouse BaF3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse B lymphocyte BaF3 was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). Cells were cultured in RPMI-1640 (Gibco, Grand Island, NY, USA) medium supplemented with 10% fetal bovine serum (FBS; Gibco, USA) and 2 ng/mL murine IL-3 (R&D Systems, Inc., Minneapolis, MN, USA) at 37°C in a humidified atmosphere of 5% CO2.
A Sirt1 expression vector pc-Sirt1 was constructed by subcloning the full-length wild-type Sirt1 coding sequence into pcDNA3.1 (Sangon Biotech, Shanghai, China). The empty construct pcDNA3.1 plasma was transfected into cells as a control group. Moreover, Sirt1-shRNA vector was constructed by GenePharma (Shanghai, China). Scrambled shRNA (GenePharma, Shanghai, China) acted as the blank control. Cell transfections were conducted with Lipofectamine 2000 reagent (Invitrogen) following the manufacturer’s protocol. G418 (Gibco, Paisley, UK) was used for selection of stable Sirt1 transfectants.
A Sirt1 expression vector pc-Sirt1 was constructed by subcloning the full-length wild-type Sirt1 coding sequence into pcDNA3.1 (Sangon Biotech, Shanghai, China). The empty construct pcDNA3.1 plasma was transfected into cells as a control group. Moreover, Sirt1-shRNA vector was constructed by GenePharma (Shanghai, China). Scrambled shRNA (GenePharma, Shanghai, China) acted as the blank control. Cell transfections were conducted with Lipofectamine 2000 reagent (Invitrogen) following the manufacturer’s protocol. G418 (Gibco, Paisley, UK) was used for selection of stable Sirt1 transfectants.
3
Metastatic Potential of Hepatocarcinoma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human hepatocarcinoma cell lines MHCC97H, MHCC97L and human normal liver cell line L02 were purchased from the KeyGEN Company (Nanjing, China). MHCC97H and MHCC97L cell clones of the same genetic background but with different metastatic potential. The three cell lines were grown in 90% Dulbecco Modified Eagle's Medium (DMEM, Gibco) supplemented with antibiotics (1× penicillin/streptomycin 100 U/ml, Gibco) and 10% heat-inactivated fetal bovine serum (FBS, Gibco). The cells were incubated in a humidified atmosphere of 5% CO2 at 37°C.
shRNA against FUT8, scrambled shRNA, miRNA-34a/miR-26a/miR-455-3p/ normal control (NC) mimics, and miRNA-34a/miR-26a/miR-455-3p/NC inhibitors were chemically synthesized by Shanghai GenePharmaCo., Ltd. (Shanghai, China). MHCC97H and MHCC97L cells were transfected with miRNAs (100 nM, the cell transfection efficiency was 72.3% ~78.5%) or shRNAs (50 nM, the cell transfection efficiency was 76.1%) using Lipofectamine 2000 Transfection Reagent (Invitrogen).
shRNA against FUT8, scrambled shRNA, miRNA-34a/miR-26a/miR-455-3p/ normal control (NC) mimics, and miRNA-34a/miR-26a/miR-455-3p/NC inhibitors were chemically synthesized by Shanghai GenePharmaCo., Ltd. (Shanghai, China). MHCC97H and MHCC97L cells were transfected with miRNAs (100 nM, the cell transfection efficiency was 72.3% ~78.5%) or shRNAs (50 nM, the cell transfection efficiency was 76.1%) using Lipofectamine 2000 Transfection Reagent (Invitrogen).
4
Lentiviral Transduction of THP-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human THP-1 cells were purchased from ATCC and cultured in RPMI-1640 medium (HyClone, Logan, Utah) with 10% FBS (Gibco, Hong Kong) containing 1% penicillin–streptomycin solution and 0.05 mM β-Mer (Invitrogen, Camarillo, CA, USA) at 37 °C in a humidified 5% CO2 atmosphere. THP-1 cells were infected with the LV5 (EF-1aF/GFP&Puro) lentiviral vector carrying the target gene sequence or a scrambled shRNA purchased from GenePharma. Inc (Shanghai, China) according to the manufacturer’s protocol. To select cells expressing the plasmids, cells were selected with puromycin (Solarbio, Beijing, China) or sorted using a BD FACS Arial III. The human siTRIM21 sequence (UGGCAUGGAGGCACCUGAAGGUGG) was ordered from GenePharma. Inc (Shanghai, China). The siRNAs were transfected at 20 nM final concentration using the FECTTM CP Reagent (Ribo, Guangzhou, China) and analyzed 48 h after transfection according to the manufacturer’s instruction.
5
Modulating FUT4 Expression in Colorectal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shRNA against FUT4, scrambled shRNA, miR-26a/miR-20b/ normal control (NC) mimics, and miR-26a/miR-26b/NC inhibitors were chemically synthesized by Shanghai GenePharma Co.,Ltd. (Shanghai, China). SW480 and SW620 cells were transfected with miRNAs (100 nM,) or shRNAs (50 nM) using Lipofectamine 2000 Transfection Reagent (Invitrogen).
6
TRIM28 Knockdown using shRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For TRIM28 knockdown, two kind of human TRIM28-targeting short hairpin RNA (shRNA) oligonucleotide sequences and a scrambled shRNA as a negative control were cloned into vector. The shRNA sequences were shTRIM28#1: CT-GAGACCAAA CCTGTGCTTA and shTRIM28#2: CCTG-GCTCTGTTCTCTGTCCT (Su et al. 2018) (link). The synthetic TRIM28-targeting shRNA, scrambled shRNA and TRIM28 mimics were obtained from GenePharma (Shanghai, China). After cells were cultured in 12-well plates for 24 h, TRIM28targeting shRNA, scrambled shRNA and TRIM28 mimics were transfected into cells by Lipofectamine 3000 (Invitrogen).
7
Silencing MGAT5 in HTR8/SVneo Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
This is the authors' final accepted manuscript, post peer review. The version of record may be found at http://dx.doi.org/10.1016/j.placenta.2015.08.014 medium (Gibco) with 10% fetal bovine serum (FBS) at 37℃ in an incubator with 5% CO 2 . For gelatinolytic zymography, cells were cultured in serum-free media. According to the manufacturer's protocol, when the cells reached 70-80% confluence, the cells were transfected with a lentivirus vector-based short hairpin RNA (shRNA) directed against the sequence of MGAT5 (MGAT5 shRNA) [28] or with a negative control (scrambled shRNA) (GenePHarma, Shanghai, China). After screening using puromycin, a stable HTR8/ SVneo cell line with the silenced human MGAT5 gene was obtained and then used for the subsequent experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!