cDNA was synthesized from total RNA with the TransPlex Complete Whole Transcriptome Amplification kit (Sigma-Adrich, USA) following the manufacturer’s instructions.
Transplex complete whole transcriptome amplification kit
Manufactured by Merck Group
Sourced in United States
The TransPlex Complete Whole Transcriptome Amplification Kit is a laboratory product designed for the amplification of whole transcriptomes. It provides a method for generating cDNA from total RNA samples, enabling further analysis and applications.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (6 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Hybridization buffer and blocking agent, by Agilent Technologies (2 mentions)
1.5 ml microcentrifuge tube, by Eppendorf (2 mentions)
Ge wash buffer 1, by Agilent Technologies (2 mentions)
Ge wash buffer 2, by Agilent Technologies (2 mentions)
Dna enzymatic labelling kit, by Agilent Technologies (2 mentions)
C elegans 4x44k microarray, by Agilent Technologies (2 mentions)
G2539a scanner, by Agilent Technologies (2 mentions)
Feature extraction software 10, by Agilent Technologies (2 mentions)
Genechip human mapping 250k nsp assay kit, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Rneasy ffpe kit, by Qiagen (1 mentions)
Repli g ffpe kit, by Qiagen (1 mentions)
Hipure total rna mini kit, by Magen Biotechnology Co (1 mentions)
Purelink rna kit, by Thermo Fisher Scientific (1 mentions)
Genechip fluidics station 450, by Thermo Fisher Scientific (1 mentions)
Verso cdna kit, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Steponeplus system, by Thermo Fisher Scientific (1 mentions)
12 protocols using transplex complete whole transcriptome amplification kit
1
Whole Transcriptome Amplification from Total RNA
2
Whole Transcriptome Amplification from FFPE Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from micro-dissected-FFPE samples were extracted using RNeasy FFPE kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instruction. The extracted RNA was then subjected to a 10-minute RNase-free DNase I treatment at 65°C. Using visible and UV/visible spectrophotometers, a ratio of 260/280 nm absorbance was measured to estimate the amount and purity of the total RNA (Thermo Scientific, Wilmington, DE, USA). A total of 25 ng of total RNA was utilized as a template for TransPlex® Complete Whole Transcriptome Amplification Kit, or WTA (Sigma, St. Louis, MO, USA). In the first phase, sample RNA was reverse transcribed with substantially non-self-complementary primers without 3’ bias. The resulting Omniplex® cDNA library was then amplified by PCR using the universal primer to create WTA products. This library is made up of random, overlapping fragments flanked by universal end sequences. WTA products were re-amplified using REPLI-g FFPE kit (Qiagen, Valencia, CA, USA) according to the company’s recommendation. The resultant amplified products were purified using a PCR purification kit after amplification (Qiagen, Valencia, CA, USA). Using visible and UV/visible spectrophotometers, the concentration and purity of purified cDNA were determined (Thermo Scientific, Wilmington, DE, USA).
3
Transcriptome Analysis of C. elegans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Worms were collected as young adults 46 h after a 1 h synchronization by collecting hatching L1 larvae as described above. Single worms were then washed, collected in a 1.5 ml microcentrifuge tube (Eppendorf) and snap-frozen in liquid nitrogen. Total RNA was extracted using an RNAClean XP kit (Agentcourt) following the manufacturer’s instructions and amplified using the TransPlex Complete Whole Transcriptome Amplification Kit (Sigma Aldrich) to generate cDNA. Cy3-labeled cDNA was prepared from 500 ng of double-stranded cDNA using the DNA Enzymatic Labelling Kit (Agilent) according to the manufacturer’s instructions, followed by purification with a 30 kDa column (Amicon). Dye incorporation and cDNA yield were checked with the NanoDrop ND-1000 Spectrophotometer (ThermoScientific). cDNA was mixed with hybridization buffer and blocking agent (Agilent) and incubated at 95 °C for 3 min before cooling on ice. cDNA was then hybridized to a custom C. elegans 4x44K microarray (Agilent) for 40 h at 65 °C. Microarrays were washed 1 min at room temperature with GE wash buffer 1 (Agilent) and 1 min at 37 °C with GE wash buffer 2 (Agilent), then dried immediately by brief centrifugation. Microarrays were scanned on a G2539A scanner (Agilent) at 5 µm resolution and 100 % PMT. Probe intensities were extracted and their quality was assessed with the Feature Extraction software 10.7 (Agilent).
4
Prostate Massage Urine Collection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First morning urine was collected after prostate massage before prostate
examination in all patients. The massage maneuver: Press from both sides of the
prostate to the central line for 3 times, followed by massaging the central line
from top to bottom for 3 times. The initial urine after micturition was
collected (about 50 mL) and stored at 4°C, which was then centrifuged at ×4000
rpm for 15 minutes at 4°C within 3 hours. After removing the supernatant, the
urine sediment was washed again with cold PBS (×1) and centrifuge at ×5000 rpm
for 15 minutes at 4°C. Discard the supernatant, homogenize the sediment in 1.5
mL centrifuge tubes for RNA extraction or further use. Extract the total RNA of
urine sediment with the manufacturer’s instructions (HiPure Total RNA Mini Kit,
Magen, China). The RNA concentration and purity were measured using Nanodrop
2000 (Thermo Scientific, US) and those with an RNA concentration lower than 5
ng/μL were excluded. Amplify the complementary DNA with TransPlex Complete Whole
Transcriptome Amplification Kit (WTA2, SIGMA, China) according to the
manufacturer’s instructions.
examination in all patients. The massage maneuver: Press from both sides of the
prostate to the central line for 3 times, followed by massaging the central line
from top to bottom for 3 times. The initial urine after micturition was
collected (about 50 mL) and stored at 4°C, which was then centrifuged at ×4000
rpm for 15 minutes at 4°C within 3 hours. After removing the supernatant, the
urine sediment was washed again with cold PBS (×1) and centrifuge at ×5000 rpm
for 15 minutes at 4°C. Discard the supernatant, homogenize the sediment in 1.5
mL centrifuge tubes for RNA extraction or further use. Extract the total RNA of
urine sediment with the manufacturer’s instructions (HiPure Total RNA Mini Kit,
Magen, China). The RNA concentration and purity were measured using Nanodrop
2000 (Thermo Scientific, US) and those with an RNA concentration lower than 5
ng/μL were excluded. Amplify the complementary DNA with TransPlex Complete Whole
Transcriptome Amplification Kit (WTA2, SIGMA, China) according to the
manufacturer’s instructions.
5
Microarray-based Transcriptome Analysis of MSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from MSCs using PureLink RNA kit (Ambion #12183018 A) and 25 ng were amplified using the TransPlex® Complete Whole Transcriptome Amplification Kit (WTA2, Sigma Aldrich). The cDNA (8 μg) was subsequently fragmented and labeled using GeneChip Human Mapping 250K Nsp Assay Kit (Affymetrix,Santa Clara, CA) according to manufacturer’s instructions, and was hybridized to the Affymetrix® MG-430 PM Array for 16 h at 45 °C. Washing, staining and scanning of microarrays was performed using a GeneAtlas Fluidics station and scanner (Affymetrix).
6
Genome-wide expression profiling of cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For expression analysis, total RNA was isolated from 107 cells using the RNeasy Mini Kit (Qiagen) and cDNAs were generated from 25 ng of total RNA and subjected to PCR amplification (17 cycles) using the TransPlex® Complete Whole Transcriptome Amplification Kit (Sigma, WTA2) according to manufacturer's instructions. 8 μg of amplified cDNAs were fragmented and labeled using the GeneChip Human Mapping 250K Nsp Assay kit (Affymetrix, 900766) according to manufacturer's instructions. Labeled cDNAs were then hybridized in GeneChip Drosophila Genome arrays 2.0 from Affymetrix (Thermo Fisher, 900531) for 16 h at 45°C. After incubation, the arrays were processed in the GeneChip Fluidics Station 450 from Affymetrix and scanned in GSC3000 System from Affymetrix.
For RT-qPCR analysis, total RNA was isolated from 107 cells using the RNeasy Mini Kit (Qiagen). For cDNA synthesis, 1 μg of total RNA was used and qPCRs were run in triplicate in at least 4 independent experiments. Expression data were normalized to Rpl32 and analyzed using ΔΔCt method. Primers used in these experiments are described inSupplementary Table S1 .
For RT-qPCR analysis, total RNA was isolated from 107 cells using the RNeasy Mini Kit (Qiagen). For cDNA synthesis, 1 μg of total RNA was used and qPCRs were run in triplicate in at least 4 independent experiments. Expression data were normalized to Rpl32 and analyzed using ΔΔCt method. Primers used in these experiments are described in
7
Sequence-Independent Transcriptome Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total NA was subjected to complementary deoxyribonucleic acid (cDNA) synthesis and sequence-independent preamplification (SIP) using the Transplex Complete Whole Transcriptome Amplification Kit (WTA1; Sigma-Aldrich, St. Louis, MO), following a published protocol [10 (link)]. In brief, 3.5 μL total NA was denatured at 95oC for 5 minutes instead of 70oC before cDNA synthesis to ensure amplification of both DNA and ribonucleic acid (RNA) molecules. Denatured NA was cooled to 18oC, and cDNA was synthesized using the following thermocycling conditions: 18oC 10 minutes, 25oC 10 minutes, 37oC 30 minutes, 42oC 10 minutes, 70oC 20 minutes, and 4oC holding. The entire cDNA library was used as template for SIP using the following cycling conditions repeated 22 times: 94oC 30 seconds and 70oC 5 minutes. After amplification, polymerase chain reaction (PCR) products were visualized on an agarose gel before purification using the ChargeSwitch-Pro PCR CleanUp Kit (Thermo Fisher Scientific).
8
Isolating and Amplifying RNA from Genetically Modified Flies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TMets (GFP+) were dissected from Apc-Ras-Sns flies between 3 and 4 weeks after induction and incubated for 15 min at 65 °C in Lysis buffer (20 mM DTT, 10 mM Tris.HCl ph 7.4, 0.5% sodium dodecyl sulfate, 0.5 µg/µl proteinase K). RNA was isolated with a RNA clean XP Kit (Agencourt Bioscience). cDNA synthesis and amplification was performed by a TransPlex® Complete Whole Transcriptome Amplification Kit (WTA2–50RXN, Sigma-Aldrich).
9
Extraction and Quantification of Endothelial Cell RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of ECs from tissue sections obtained by LCM method was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) and purified with RNeasy Minikits (Qiagen, Valencia, CA) according to the manufacturers’ protocols. A cDNA library was prepared with WTA2, TransPlex Complete Whole Transcriptome Amplification Kit (Sigma-Aldrich, St. Louis, MO), which was then amplified using a universal end primer.
To harvest RNA from HDMECs, the RNeasy Minikit (Qiagen, Valencia, CA) was used and cDNA was made according to the manufacturer’s instructions with Verso cDNA kit (ThermoScientific, Waltham, MA).
Quantitative real-time (qRT-PCR) was performed with the following primers: Grp78 (Hs99999174_m1), ATF4 (Hs00909569_g1), CHOP (Hs01090850_m1) and β-tubulin (Hs 03929064_g1) using Gene Expression Assays reagents (Applied Biosystems, Carlsbad, CA). All reactions were done in triplicates and normalized to β-tubulin.
To harvest RNA from HDMECs, the RNeasy Minikit (Qiagen, Valencia, CA) was used and cDNA was made according to the manufacturer’s instructions with Verso cDNA kit (ThermoScientific, Waltham, MA).
Quantitative real-time (qRT-PCR) was performed with the following primers: Grp78 (Hs99999174_m1), ATF4 (Hs00909569_g1), CHOP (Hs01090850_m1) and β-tubulin (Hs 03929064_g1) using Gene Expression Assays reagents (Applied Biosystems, Carlsbad, CA). All reactions were done in triplicates and normalized to β-tubulin.
10
Quantitative Real-Time PCR for Prostate Cancer Biomarkers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of the samples was extracted using TRIzol reagent. Sense-strand cDNA was synthesized and amplified using the TransPlex Complete Whole Transcriptome Amplification Kit (WTA2, Sigma–Aldrich, St. Louis, MO) according to the manufacturer’s instructions. Quantitative reverse transcription polymerase chain (qRT-PCR) was performed using THUNDERBIRD™ SYBR® qPCR Mix (TOYOBO: QPS201) and a Step One Plus system (Applied Biosystems, USA). The amplification conditions were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15s and 60°C for 60s. The primer sequences for the qRT-PCR were as follows: PSA-forward GTCTGCGGCGGTGTTCTG, PSA-reverse TGCCGACCCAGCAAGATC; PCA3-forward GAGAACAGGGGAGGGAGAG, PCA3-reverse CATGTCGCTGGCCTCTCAA; lncRNA546-forward TCCTCCTAAGCCGTATCCCATCTG, lncRNA546-reverse CCAGGTGAGTTGAACAGTCCGATT. The data were analyzed using StepOne Software v2.1 (Applied Biosystems, USA). To eliminate samples with insufficient prostate cell collection, samples with PSA cycle threshold (Ct) values over 28 were excluded. The lncRNA546 score was calculated based on the formula lncRNA546 mRNA/PSA mRNA × 100 = 2Ct(PSA)-Ct (lncRNA546) × 100, and the PCA3 score was calculated as previously described (16 (link)). All experiments were performed in triplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!