Total RNA in sorted endothelial cells, embryos, normal or tumor tissues (grinded in liquid nitrogen) was extracted by Trizol and reverse transcribed into cDNA by RT Master Mix (TOYOBO) according to the manufacturer’s instructions. Subsequent quantitative PCR was performed with SYBR Green Real-time PCR Master Mix (TOYOBO). Gene expression was normalized to the endogenous control zebrafish actb or mouse Actb. All qPCR reactions were run on ABI VIIA7 real-time PCR instrument and data were calculated using the ΔΔCt method. Primers used for qPCR analysis were listed in Table S1 .
Rt master mix
Manufactured by Toyobo
Sourced in Japan
RT Master Mix is a ready-to-use solution for reverse transcription and PCR amplification. It contains all the necessary components, including reverse transcriptase and DNA polymerase, for efficient cDNA synthesis and subsequent PCR.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Sybr green realtime pcr master mix, by Toyobo (1 mentions)
Thunderbird next sybr qpcr mix, by Toyobo (1 mentions)
Rotor gene q 6plex system, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Nanodrop, by DeNovix (1 mentions)
Rnaeasy reagent, by Qiagen (1 mentions)
Lightcycler 480 system, by Roche (1 mentions)
Revertra ace, by Toyobo (1 mentions)
Thunderbird sybr qpcr mix, by Toyobo (1 mentions)
Sepasol rna 1 super g, by Nacalai Tesque (1 mentions)
Revertra acer, by Toyobo (1 mentions)
Thermal cycler dice real time system 2, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Sybr green, by Toyobo (1 mentions)
Sybr green real time pcr mix, by Toyobo (1 mentions)
Abi steponeplus instrument, by Thermo Fisher Scientific (1 mentions)
Sybr qpcr master mix, by Toyobo (1 mentions)
Lightcycler apparatus, by Roche (1 mentions)
Brilliant sybr green qpcr master mix, by Takara Bio (1 mentions)
12 protocols using rt master mix
1
Quantitative analysis of gene expression
2
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells treated with HSDP were detached using trypsin and washed with PBS before storage at -80°C until RNA extraction. For this purpose, a minimum of 1 x106 cells per experimental group were processed using the RNeasy Mini kit (#74104; QIAGEN). The mRNA levels were measured with the NanoDrop (DS-11, DeNovix), followed by cDNA synthesis using RT Master Mix (FSQ-201, TOYOBO, Japan) following the manufacturer’s instructions. Quantitative real-time PCR (qRT-PCR) involved reaction mixtures containing 10 μL THUNDERBIRDTM Next SYBR® qPCR Mix (QPS-201, TOYOBO, Japan), 1 μL (10 pmol/μL) of forward primer, 1 μL (10 pmol/mL) of reverse primer, 7 μL of Nuclease-Free Water, and 1 μL of cDNA in a PCR plate. The amplification was carried out with the Rotor-Gene Q 6plex System (Rotor-Gene Q, Qiagen, Germany) through 40 cycles: denaturation at 95°C for 15 s, annealing at 62°C for 1 min, and extension at 72°C for 1 min. Each plate had at least three replications. The quantification of each target gene expression was standardized against the endogenous control gene (GAPDH) and a list of the primers is shown in S1 Table in S1 File . Relative expressions were calculated using the formula:
3
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After extraction of total RNA with RNAeasy reagents (QIAGEN), reverse transcription was performed with ReverTra Ace quantitative polymerase chain reaction (qPCR) RT Master Mix (TOYOBO). PCRs were carried out in the LightCycler480 system (Roche) with THUNDERBIRD SYBR qPCR Mix according to the manufacturer’s instructions (TOYOBO). Each assay was performed in triplicate, and the results were normalized to 18S ribosomal RNA. Primer sequences are listed in supplemental Table 3.
4
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by Sepasol RNA I Super G (Nacalai Tesque) and cDNA synthesized using ReverTra AceR quantitative polymerase chain reaction (qPCR) reverse transcriptase (RT) Master Mix (TOYOBO). qPCR was performed with the Thermal Cycler Dice Real Time System II (Takara Bio) according to the manufacturer’s instructions. The primer sequences for each gene were as follows: EAP1 (forward, 5′-tcgcttcaagaaggaccact-3′ and reverse, 5′-ccgtggggtactcaatgaac-3′); PSA (forward, 5′-ggcagcattgaaccagaggag-3′ and reverse, 5′-gcatgaacttggtcaccttctg-3′); and KLK2 (forward, 5′-tcatccagtctcggattgtg-3′ and reverse, 5′-cttctttaggcaatgggcag-3′); and Nkx3.1 (forward, 5′-gccaagaacctcaagctcac-3′ and reverse, 5′-agaaggcctcctctttcagg-3′); and Rplp0 (forward, 5′-tcgacaatggcagcatctac-3′ and reverse, 5′-tgatgcaacagttgggtagc-3′). RNA levels were normalized using the Rplp0 gene as an internal control.
5
Quantitative RT-PCR Analysis of Cell Cycle Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol reagent following the manufacturer’s protocol (TaKara). Reverse transcription was performed using RT master mix (Toyobo), and PCR was run using SYBR Green (Toyobo). Primers used to amplify CELF6, p53, p27, p21, Gadd45α, Wee1, PTEN, E2F1, cyclin B1, and ACTB transcripts were listed in Table 1 . ACTB was used as an internal control.
Primers used for RT-PCR and RIP assay
| Primer name | Sequence |
|---|---|
| ACTB-RT-F | 5′-CATGTACGTTGCTATCCAGGC-3′ |
| ACTB-RT-R | 5′-CTCCTTAATGTCACGCACGAT-3′ |
| CELF6-RT-F | 5′-CCCATCGGGGTCAATGGATTC-3′ |
| CELF6-RT-R | 5′-GCCCGTTATTGTAGAGCGTGT-3′ |
| Cyclin B1-RT-F | 5′-AATAAGGCGAAGATCAACATGGC-3′ |
| Cyclin B1-RT-R | 5′-TTTGTTACCAATGTCCCCAAGAG-3′ |
| p27-RT-F | 5′-ATCACAAACCCCTAGAGGGCA-3′ |
| p27-RT-R | 5′-GGGTCTGTAGTAGAACTCGGG-3′ |
| Gadd45α-RT-F | 5′-GAGAGCAGAAGACCGAAAGGA-3′ |
| Gadd45α-RT-R | 5′-CAGTGATCGTGCGCTGACT-3′ |
| Wee1-RT-F | 5′-GACGAAGATGATTGGGCATCC-3′ |
| Wee1-RT-R | 5′-TGGACTGGAGATCCTTGTTACA-3′ |
| PTEN-RT-F | 5′-AGGGACGAACTGGTGTAATGA-3′ |
| PTEN-RT-R | 5′-CTGGTCCTTACTTCCCCATAGAA-3′ |
| p53-RT-F | 5′-AAAGTGCGTCCGTTCTCAATG-3′ |
| p53-RT-R | 5′-GGTTCTTCCTCAGAGTACCAAAG-3′ |
| E2F1-RT-F | 5′-CATCCCAGGAGGTCACTTCTG-3′ |
| E2F1-RT-R | 5′-GACAACAGCGGTTCTTGCTC-3′ |
| p21-RT-F | 5′-AGCGATGGAACTTCGACTTTG-3′ |
| p21-RT-R | 5′-CGAAGTCACCCTCCAGTGGT-3′ |
6
Quantifying Gene Expression via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol reagent (Invitrogen, USA). One microgram of RNA was used to synthesize cDNAs with the RT Master Mix (Toyobo, Japan). Real-time PCR was performed using SYBR Green real-time PCR mix (Toyobo, Japan) with specific primers (Supplementary Tables 1 , 2 ). The RT-qPCRs were cycled using an ABI StepOnePlus instrument (Applied Biosystems, USA) under standard cycling conditions. Target gene expression levels were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Relative RNA levels were calculated using the comparative cycle threshold (CT) method (2−ΔΔCT method), where CT indicates the amplification cycle number at which the fluorescence generated within a reaction increases above a defined threshold fluorescence, and ΔΔCT = experimental sample (CTtarget gene − CTGAPDH) − control sample (CTtarget gene − CTGAPDH).
7
qRT-PCR Analysis of Metabolic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For qRT-PCR analysis of monocarboxylate transporter 1 (Slc16a1 (Mct1)), lactate dehydrogenase A (Ldha), and hydrocarboxylic acid receptor 1 (Hcar1 or Gpr81) genes, total RNA was isolated using the Trizol reagent (Thermo Fisher Scientific, Inc., 15596026) from BAT and then first-strand cDNAs were synthesized using RT Master Mix (Toyobo co., ltd, FSQ-201). Real-time qPCR was performed in sealed 96-well plates with SYBR qPCR master Mix (Toyobo co., ltd, QPS- 201). qPCR reactions were prepared in a final volume of 20 μl containing 2 μl cDNA and 10 μl of SYBR qPCR master Mix in the presence of primers at 0.5 μM. TATA box binding protein (Tbp) was used as an internal control for quantification of each sample. A list of primer sets included: F5′-aatgctgccctgtcctccta-3′ and R5′-cccagtacgtgtatttgtag-3′ for Slc16a1, F5′-tcgtgcactagcggtctcaa-3′ and R5′-aacagcaccaaccccaaca-3′ for Ldha, F5′-tttgccagaggtgttgaagc-3′ and R5′-ggatactcaggttggtggct-3′ for Hcar1, and F5′-ccccttgtacccttcaccaat-3′ and R5′-gaagctgcggtacaattccaga-3′ for Tbp. Relative gene expression was determined using the ΔΔCt method. Relative mRNA expression levels were presented as a fold change compared with those of the control group.
8
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted by TRIzoL rapid extraction method as above. RNA was reverse transcribed using 5 × RT Master Mix (TOYOBO, Japan) and 2 μg RNA template. The amplification procedure was used as follow: 37°C for 15 min; 50°C for 5 min and 98°C for 5 min in PCR Amplifier (Biometra, Germany). RT‐PCR was performed using 25 ng of cDNA samples using 5 mmol/L of each primer (Table 2 ) and 5 μl of Brilliant SYBR Green QPCR Master Mix (Takara, Japan) in a Light Cycler apparatus (Roche, Switzerland). The amplification procedure was used: 95°C for 5 min; 40 cycles at 95°C for 5 s; 60 °C for 30 s. All values were normalized to the GAPDH housekeeping gene and relative expressed as fold change using the formula 2−△△Ct. The primers for RT‐PCR are listed in Table 2 .
9
Quantitative Real-Time PCR Analysis of Immune Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PBMC, OVSAHO and MCAS cells were lysed in 350 μL/well of FARB buffer (Favorgen) containing 3.5 μL/well of 98% 2‐mercaptoethanol (Sigma‐Aldrich), and the Blood/Cultured Cell Total RNA Mini Kit (Favorgen) was used to extract total RNA from the cells. cDNA was synthesized using 5 × RT Master Mix (Toyobo) according to the manufacturer's instructions, and qRT‐PCR was performed in duplicate using SYBR Green I Master Mix and a LightCycler 480 (Roche) according to the manufacturer's protocols. Forward and reverse primer sequences were: PD‐L1, 5′‐GGCATTTGCTGAACGCAT‐3′ and 5′‐CAATTAGTGCAGCCAGGT‐3′; IL‐6, 5′‐ACAAGCCAGAGCTGTGCAGATG‐3′ and 5′‐GTGCCCATGCTACATTTGCCGA‐3′; TGF‐β, 5′‐GCTGCCTGTGTGACTTTGG‐3′ and 5′‐TCCTGGATTCTAGCACTTCTGG‐3′; ROR‐γt, 5′‐GTGGGGACAAGTCGTCTGG‐3′ and 5′‐AGTGCTGGCATCGGTTTCG‐3′; IFN‐γ, 5′‐CGAGGGTTGAATGAGAGCTT‐3′ and 5′‐CAGACGGCTGCCTTTATAGC‐3′; GAPDH, 5′‐GAAAGGTGAAGGTCGGAGTC‐3′ and 5′‐GAAGATGGTGATGGGATTTC‐3′; IL‐17, 5′‐AGAGATATCCCTCTGTGATC‐3′ and 5′‐CACCCCAAAATTGTCTCAGG‐3′; IL‐27, 5′‐GAGCAGCTCCCTGATGTTTC‐3′ and 5′‐AGCTGCATCCTCTCCATGTT‐3′; tumor necrosis factor α (TNF‐α), 5′‐GGCGTGGAGCTGAGAGATAAC‐3′ and 5′‐GGTGTGGGTGAGGAGCACAT‐3′; and IL‐23A, 5′‐CAGTTCTGCTTGCAAAGGAT‐3′ and 5′‐ATCTGCTGAGTCTCCCAGTG‐3′. All the Ab were from Sigma‐Aldrich. The ratio of each gene product to GAPDH was used to determine mRNA expression according to the cycle‐threshold method.
10
RNA Extraction and Quantitative RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from HAECs using TRIzol. The concentration of RNA was assessed using a NanoDrop 2000c spectrophotometer. The reverse transcription system included 5 × RT master Mix (2 µl, TOYOBO, Japan), RNA template (1 µg), and RNase-free water in a final volume of 10 µl. The reaction conditions were as follows: 37 °C for 15 min, 50 °C for 5 min, and 98 °C for 5 min. Real-time PCR was performed using a SYBR probe (Applied Biosystems, USA). An ABI 7900HT (Applied Biosystems, USA) thermocycler was used for qPCR amplifications. Relative expression (fold change vs. control) was calculated with the 2-ΔΔCt method using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA as the reference. The primer sequences used are shown in Supplemental Table 2 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!