The colorectal cancer tissue microarray used in this study was purchased from Zhuoli Biotech (#COC1504, http://www.zhuolibiotech.com/ , Shanghai, China). For immunohistochemical analysis, paraffin-embedded tissue sections were deparaffinized in xylene and rehydrated through descending concentrations of ethanol. Then antigen retrieval was performed by boiling in 10 mM citrate buffer (pH 6.0) for 10 min, followed by treatment with 3% hydrogen peroxide to block endogenous peroxidase. After washing with 1 × PBS for three times, the sections were incubated with a primary antibody overnight at 4 °C. The antibodies used for immunohistochemistry were listed as follows: PIPKIγ (1: 200, Proteintech, 27,640-1-AP), PCNA (1:5000, Cell Signaling Technology, #13110), HIF1α (1: 300, Abcam, ab113642), c-Myc (1: 500, Abcam, ab32072), GLUT1 (1:200, Proteintech, 21,829-1-AP), LDHA (1:200, Proteintech, 19,987-1-AP), and PDK1 (1:200, Proteintech, 10,026-1-AP). The next day, the HRP-conjugated secondary antibody was added for 45 min at room temperature. The immunoreactivity was developed by 3,3′-diaminobenzidine (DAB). Finally, the sections were counterstained with hematoxylin and scoring was evaluated by two investigators blinded to the clinical information.
Ab113642
Manufactured by Abcam
Sourced in United States, United Kingdom
Ab113642 is a primary antibody produced in rabbit that recognizes an epitope within the human alpha-Actinin-4 protein. This antibody is suitable for use in various immunoassay applications.
Automatically generated - may contain errors
Lab products found in correlation
Pvdf membrane, by Merck Group (2 mentions)
Ab32072, by Proteintech (1 mentions)
Pipkiγ, by Proteintech (1 mentions)
Proliferating cell nuclear antigen (pcna), by Cell Signaling Technology (1 mentions)
Ab58176, by Abcam (1 mentions)
Ecl plus kit, by GE Healthcare (1 mentions)
Horseradish peroxidase conjugated anti mouse secondary antibody, by Santa Cruz Biotechnology (1 mentions)
Mouse monoclonal anti β actin, by Merck Group (1 mentions)
Quantity one software, by Bio-Rad (1 mentions)
Sds page, by Bio-Rad (1 mentions)
Ab13575, by Abcam (1 mentions)
Ab76495, by Abcam (1 mentions)
Ab13585, by Abcam (1 mentions)
Ab109520, by Abcam (1 mentions)
Ab21685, by Abcam (1 mentions)
Protein assay reagent, by Bio-Rad (1 mentions)
Ecl detection system, by Merck Group (1 mentions)
Ab8227, by Abcam (1 mentions)
Lysis buffer, by Beyotime (1 mentions)
Horseradish peroxidase conjugated secondary antibody, by Beyotime (1 mentions)
16 protocols using ab113642
1
Colorectal Cancer Tissue Microarray Immunohistochemistry
2
Western Blot Analysis of HIF-1α and CXCR4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Equal amounts (40 µg) of protein lysate were separated by SDS-PAGE (Bio-Rad, USA) and transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore, USA). The membranes were blocked with TBST containing 5% non-fat dry milk for 1 h and incubated with a mouse monoclonal primary antibody against HIF-1α (1∶300; ab113642, Abcam) or mouse monoclonal anti-CXCR4 (1∶300; ab58176, Abcam) and mouse monoclonal anti-β-actin (1∶1000; Sigma-Aldrich) overnight at 4°C. After washing three times with TBST, the membranes were incubated with horseradish peroxidase-conjugated anti-mouse secondary antibody (Santa Cruz, USA) for 2 h. The membranes were again washed three times in TBST, and the proteins were visualized using the enhanced chemiluminescence (ECL) Plus kit (GE Healthcare Bio-Sciences). β-actin was used as a control. The optical density of protein fragments was quantified using Quantity One software (Bio-Rad, USA).
3
Western Blot Analysis of Apoptosis Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protein levels of TK, VP3, Grp78, and HIF-1α as well as p21, p53, APC1, cytochrome C,
and caspase-3 were determined by Western blotting. Briefly, total proteins were extracted
from NPC cells, and the proteins were quantified with protein assay reagent from Bio-Rad
(Hercules, California). Proteins were then loaded on 10% sodium dodecyl sulfate
polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride or
polyvinylidene difluoride membranes. The membranes were subsequently blocked using 5%
nonfat milk at room temperature for 1 hour. And then membranes were probed with the
specific primary antibodies (all purchased from Abcam [Cambridge, MA, USA]) against TK
(anti-thymidine kinase 1 antibody, ab76495, 1/5000), VP3 (anti-VP3 antibody, ab193612,
1/5000), Grp78 (anti-Grp78 antibody ab21685, 1/500), HIF-1α (anti-HIF-1α antibody,
ab113642,1/500), p21 (anti-p21 antibody, ab109520, 1/1000), p53 (anti-p53 antibody, ab26,
1/500), APC1 (anti-Apc1 antibody, ab133397, 1/500), cytochrome C (anti-cytochrome C
antibody, ab13575, 1/500), caspase-3 (anti-caspase-3 antibody, ab13585, 1/500) at 4°C
overnight and subsequently incubated with corresponding secondary antibody at 37°C for 45
minutes. Protein bands were scanned with the Pierce ECL Western Blotting Substrate
(Pierce, Shanghai, China). β-Actin was served as an internal control.
and caspase-3 were determined by Western blotting. Briefly, total proteins were extracted
from NPC cells, and the proteins were quantified with protein assay reagent from Bio-Rad
(Hercules, California). Proteins were then loaded on 10% sodium dodecyl sulfate
polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride or
polyvinylidene difluoride membranes. The membranes were subsequently blocked using 5%
nonfat milk at room temperature for 1 hour. And then membranes were probed with the
specific primary antibodies (all purchased from Abcam [Cambridge, MA, USA]) against TK
(anti-thymidine kinase 1 antibody, ab76495, 1/5000), VP3 (anti-VP3 antibody, ab193612,
1/5000), Grp78 (anti-Grp78 antibody ab21685, 1/500), HIF-1α (anti-HIF-1α antibody,
ab113642,1/500), p21 (anti-p21 antibody, ab109520, 1/1000), p53 (anti-p53 antibody, ab26,
1/500), APC1 (anti-Apc1 antibody, ab133397, 1/500), cytochrome C (anti-cytochrome C
antibody, ab13575, 1/500), caspase-3 (anti-caspase-3 antibody, ab13585, 1/500) at 4°C
overnight and subsequently incubated with corresponding secondary antibody at 37°C for 45
minutes. Protein bands were scanned with the Pierce ECL Western Blotting Substrate
(Pierce, Shanghai, China). β-Actin was served as an internal control.
4
Western Blot Analysis of Protein Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells were lysed for protein extraction by a lysis buffer (Beyotime, Shanghai, China). Equal amounts of protein (15 μg per lane) were separated by 10% SDS-PAGE and electrophoretically transferred onto nitrocellulose membranes. The membranes were then blocked with 5% defatted milk. After incubation overnight with primary antibodies against YBX1 (#4202, Cell Signaling Technology, Shanghai, China), Myc (#9402, Cell Signaling Technology, Shanghai, China), HIF1α (ab113642, Abcam, Cambridge, UK), and β-actin (ab8227, Abcam, Cambridge, UK), the second HRP conjugated secondary antibodies were used at room temperature for 1 h. Immunoblots were developed using the enhanced chemiluminescence (ECL) detection system (Millipore). The relative gray scale of the bands was analyzed using Image J software.
5
Protein Expression Profiling in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells were placed in the radioimmune precipitation assay buffer and then the the cellular proteins were separated with SDS-15% polyacrylamide gel electrophoresis under denaturing conditions. Then, after blocked with 5% skim milk, the nitrocellulose membrane transferred with proteins were incubated with primary antibodies against HVEM (1:500; Ab62462, Abcam, USA), HIF-1 α (1:500; Ab113642, Abcam), Bcl-2 (1:400; Sc-492, Santa Cruz Biotechnology), Bax (1:300; Sc-493, Santa Cruz Biotechnology), AKT [1:1000; #9272, Cell Signaling Technology (CST)], p-AKT (1:1000; #9271, CST), mTOR (1:1000; #2972, CST), p-mTOR (1:1000; #2971; CST) and GAPDH antibodies (1:2000; #5174, CST, Danvers, MA, USA), followed by a horseradish-peroxidase-conjugated secondary antibody (Beyotime, Shanghai, China). The signals were determined by an enhanced chemiluminescence system (Bio- Rad). GAPDH was selected as the internal control.
6
RT-PCR, Western Blot, and IHC Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The regents used and the detailed procedures of RT-PCR, western blot and IHC were performed as before [7 (link)]. For RT-PCR, GAPDH and U6 were used as the internal control. The primers of GAPDH, RASA1 were listed in Table 1 and the primers of U6 (MS00033740) and miR-182 (MS00008855) were bought from Qiagen. For western blot, β-actin (A5441, Sigma-Aldrich, 1:2000) was used as the internal control. Other primary antibodies used were Hif-1a (ab113642, abcam, 1:1000), RASA1 (ab40677, abcam, 1:1000).
Primer sequences for RT-PCR
| Name | Sense strand | Anti-sense strand |
|---|---|---|
| GAPDH | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA |
| RASA1 | GGGACATCCAATAAACGCCTTCG | TTTGCTACTTGGACACTATTCAGG |
7
Immunohistochemical Detection of HIF-1α and CXCR4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were stained with antibodies to HIF-1α (1∶500; ab113642, Abcam), CXCR4 (1∶500; ab1671, Abcam) and multi-use secondary antibody (1∶1000; Dako, Ely, UK). The primary antibody was omitted in the negative control. Staining was visualized with the EnVision™ Peroxidase/DAB Rabbit/Mouse detection kit (Dako). All experimental procedures were performed according to the ICC (IF) protocol from Abcam.
8
Immunoblotting of Signaling Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell lystates were separated using SDS-PAGE and then electrophoretically transferred onto PVDF membranes. After blocking with 5% defatted milk for 1 h at room temperature, the PVDF membranes were incubated with primary antibodies overnight at 4 °C, followed by incubation with HRP-conjugated secondary antibodies at room temperature for 45 min. β-actin antibody was used as loading control. Immunoblots were developed using the Pierce™ Western ECL Blotting substrate (ThermoFisher Scientific, Waltham, MA) and ChemiDoc Touch image system (Bio-Rad). The antibodies used were listed as follows: PIPKIγ (1: 2000, Abcam, ab109192), p-Akt (1:2000, Cell Signaling Technology, #4060), Akt (1:1000, Cell Signaling Technology, #4685), p-mTOR (1:1000, Cell Signaling Technology, #2971), mTOR (1:1000, Cell Signaling Technology, #2983), p-S6K (1:1000, Cell Signaling Technology, #9204), S6K (1:1000, Cell Signaling Technology, #9202), HIF1α (1: 1000, Abcam, ab113642), c-Myc (1: 1000, Abcam, ab32072), and β-actin (1:1000, Abcam, ab8227).
9
Evaluation of Tumor Vessel PD-L1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For evaluation of the percent of CD34+ PD-L1+ vessels in tumor tissues. All patient sections were double-stained with anti-CD34 antibody (ZA-0550, ZSGB-BIO) and anti-PD-L1 antibody (66248-1-lg, Proteintech) using a double-staining kit (DS-0001, ZSGB-BIO). First, the most-abundant sites of blood vessels were selected under fourfold magnification of microscope, and four sites were randomly selected under a 40-fold objective lens, and the proportion of PD-L1+ CD34+ cells in all CD34+ vessels was calculated and averaged. The average percentage was used as the final result for each section. To evaluate the positive expression of VEGFA (ab1316, Abcam) and hypoxia-inducible factor α (HIF-1α) (ab113642, Abcam), stained sections were digitally analyzed at ×400 resolution using an Olympus BX-UCB. HIF-1α and VEGFA expression were scored by the H-score system, respectively. H score calculation method is based on previous literature15 (link).
10
Western Blot Analysis of Bone Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The femoral callus tissue of each mouse was ground into powder in liquid nitrogen, and then the RIPA lysis buffer containing protease inhibitor was added. After the mixture was centrifuged at 4°C and 12,000 rpm for 20 minutes, the supernatant was collected. The protein sample was separated by SDS-PAGE and then transferred to a polyvinylidene fluoride (PVDF) film. The membrane was incubated in TBST buffer with 5% bovine serum albumin at room temperature for 1 hour and followed by incubation with anti-NF-κB (1 : 500, rabbit, ab209795, Abcam), anti-HIF-1α (1 : 1000, mouse, ab113642, Abcam), anti-BALP (1 : 500, rabbit, ab108337, Abcam), anti-BGP (1 : 200, rabbit, ab93876, Abcam), anti-Runx2 (1 : 1000, mouse, ab76956, Abcam), anti-collagen Iα1 (COLIα1) (1 : 1000, mouse, ab88147, Abcam), anti-COLIα2 (1 : 500, rabbit, ab96723, Abcam), and anti-β-actin (1 : 1000, mouse, ab8226, Abcam) overnight at 4°C. Next, the membrane was incubated with secondary antibodies (1 : 1000, Byotime) at room temperature for 1 hour. The signal was detected by an enhanced chemiluminescence kit (BeyoECL Star, P0018A, Byotime). Quantitative analysis was performed using the ImageJ software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!