Total RNA was isolated from hepatocytes using the RNeasy Mini Kit (Qiagen). cDNA was generated with 1 μg of total RNA and iScript reverse transcription supermix. Real-time PCR was subsequently performed using iTaq™ universal SYBR® Green supermixon a CFX96 real-time system(Bio-Rad) to analyze expression using 5′--3′ (forward [F]) and 5′--3′(reverse [R]) primers. iNOS: F: 5′-ACC AGA GGA CCC AGA GAC AA-3′, R: 5′-GCC TGG CCA GAT GTT CCT C-3′; IFN-β: F: 5′-TGA CGG AGA AGA TGC AGA AG-3′, R:5′-ACC CAG TGC TGG AGA AAT TG-3′; IFN-α F: 5′-CTA CTG GCC AAC CTG CTC TC-3′, R:5′- AGA CAG CCT TGC CAG GTC ATT-3′.RIG-I, F:AATCAGACAGATCCGAGACA; R:TGTCTTTC TCCAAAGCAAGT.ADAR1:F:CCGTACCATGTCCTGTAGTGACA; R:GCCCTTGGCTG AAAAGGTAAC. The TNF-α, IL-6, and IPS-1 primer were purchased from Qiagen. All data were normalized automatically using β-actin (Qiagen) as the loading control.
Tnf α
Manufactured by Qiagen
Sourced in United States, Germany
The TNF-α product is a laboratory equipment used for the detection and quantification of tumor necrosis factor alpha (TNF-α) in biological samples. It provides a reliable and sensitive method for measuring TNF-α levels, which is a key cytokine involved in various inflammatory and immune-related processes.
Automatically generated - may contain errors
Lab products found in correlation
Interleukin 6 (il 6), by Qiagen (14 mentions)
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Rneasy mini kit, by Qiagen (7 mentions)
Il 1β, by Qiagen (7 mentions)
β actin, by Qiagen (6 mentions)
Ifn γ, by Qiagen (5 mentions)
Il 10, by Qiagen (4 mentions)
Cxcl1, by Qiagen (3 mentions)
Sybr select gene expression master mix, by Thermo Fisher Scientific (3 mentions)
Stepone plus thermal cycler, by Thermo Fisher Scientific (3 mentions)
Nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Quantitect reverse transcription kit, by Qiagen (3 mentions)
Interleukin 4 (il 4), by Qiagen (2 mentions)
Tgfβ1, by Qiagen (2 mentions)
Il 17a, by Qiagen (2 mentions)
Prime script reverse transcriptase reagent, by Takara Bio (2 mentions)
Lightcycler 96, by Roche (2 mentions)
Gapdh, by Qiagen (2 mentions)
Ifn β, by Qiagen (2 mentions)
Simpliamp thermal cycler, by Thermo Fisher Scientific (2 mentions)
24 protocols using tnf α
1
Quantifying Hepatocyte Gene Expression
2
Measuring Gene Expression in Lung Tissue
3
Real-time PCR for TNFα and IL1β
4
Serum Cytokine Profiling by ELISA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole blood samples were allowed to clot for 15–30 min after collection by cardiac puncture. Serum was then separated by centrifugation at 3,000 rpm for 10 min at 4°C and stored at −80°C until use. Serum levels of IL-6, IL-1β, and IFN-γ were measured using enzyme-linked immunosorbent assay kits specific for these cytokines according to manufacturer instructions (BD Biosciences). For the ELISArray, serum samples for each group were pooled (5–10 per group). A multi-analyte ELISArray for the following cytokines was carried out per manufacturer instructions: IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-13, IL-17A, IL-23, IFN-γ, TNF-α, and TGF-β1 (QIAGEN, Germantown, MD, USA). In instances in which serum volumes were insufficient to measure all 12 cytokines, the IFN-γ well was not used and has been omitted from our analysis.
5
Aortic Valve Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
From the other half of the harvested hearts, aortic roots (from annulus to sino‐tubular junction) containing the aortic valve, were isolated. RNA from the valve was extracted using RNeasy® Mini Kit (Qiagen, ON, Canada). Then PCR were performed with the use of the QX200 Droplet Digital PCR® system. The primers used for the PCR reaction were all from Qiagen (listed below). The Quantasoft software was used to analyze the data. The results of gene expression were normalized with the use of the average of expression of the three following housekeeping genes: hypoxanthine‐guanine phosphoribosyltransferase (HPRT1), Beta‐Actin, and Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH).
Primers used:
Primers used:
BMP2: QT00012544 (Qiagen, Hilden, Germany)
BCl2: QT00156282 (Qiagen, Hilden, Germany)
Casp3: QT00260169(Qiagen, Hilden, Germany)
BGLAP: QT00259406 (Qiagen, Hilden, Germany)
RUNX2: QT00020517 (Qiagen, Hilden, Germany)
ALPL: QT00157717 (Qiagen, Hilden, Germany)
Wnt5a: QT00160958 (Qiagen, Hilden, Germany)
MMP9: QT00108815 (Qiagen, Hilden, Germany)
TIMP: forward 5‐tagtgatggttcccctcctc‐3, reverse 5‐tacttgtttgccatttccca‐3
AGRT1: QT00233548(Qiagen, Hilden, Germany)
TGFβ2: QT00058233 (Qiagen, Hilden, Germany)
TNFα: QT00115332(Qiagen, Hilden, Germany)
6
Kidney mRNA Expression Profiling via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was isolated from cross-sectioned kidney slices using an RNeasy Mini Kit (Qiagen, Hilden, Germany), and cDNA was subsequently synthetized with Prime Script Reverse Transcriptase reagent (Takara, Japan) from DNase-treated total RNA. A LightCycler 96 (Roche, Penzberg, Germany) was used to conduct qPCR. The following primers were used: interleukin-6 (IL-6, Qiagen, #QT00098875), monocyte chemoattractant protein-1 (MCP-1, Qiagen, #QT00167832), tumor necrosis factor alpha (TNFα, Qiagen, #QT00104006), and plasminogen activator inhibitor 1 (PAI-1, BioTez, Berlin, Fwd:5′-ATGTTTAGTGCAACCCTGGC-3′, Rev: 5′-CTGCTCTTGGTCGGAAAGAC-3′). Hypoxanthine phosphoribosyl transferase (HPRT, Qiagen, #QT00166768) served as housekeeper for normalization.
7
Gene Expression Analysis of Intestinal Tight Junctions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from a homogenized segment of small intestine (proximal jejunum) or colon, using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. RNase‐free DNase (Qiagen) was used to remove any contaminating DNA. RNA was reverse transcribed into cDNA and purified with QiaQuick (Qiagen). Gene expression was quantified on an Applied Biosystems StepOnePlus Real‐Time PCR System. Claudin‐1, Claudin‐2, Claudin‐3, Claudin‐4, Claudin‐5, Claudin‐15, Occludin‐1, JAM‐1, ZO‐1, Mucin‐2, IL‐17A, CD68, CXCL1, TNFα, and 18S Quantitect Primer Assays were purchased from Qiagen. Gene expression was normalized to the housekeeping gene 18S and expressed relative to the average wild‐type (AA) value using the comparative cycle threshold (Ct) method with the formula: Fold change = 2‐ΔΔCt.
8
Kidney mRNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was isolated from cross-sectioned kidney slices using RNeasy Mini Kit (Qiagen, Hilden, Germany) and cDNA was subsequently synthetized with Prime Script Reverse Transcriptase reagent (Takara, Kusatsu, Japan) from DNase-treated total RNA. A LightCycler 96 (Roche, Penzberg, Germany) was used to conduct qPCR. The following primers were used: tumor necrosis factor alpha (TNFα, Qiagen, #QT00104006) and interleukin-6 (IL-6, Qiagen, #QT00098875). Hypoxanthine phosphoribosyl transferase (HPRT) (Qiagen, #QT00166768) served as housekeeper for normalization.
9
Quantitative Analysis of Inflammatory Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from hippocampal tissues using TRIzol Reagent (Bio-Rad Laboratories S.r.l, Segrate, Italy) according to the manufacturer’s instructions. cDNA was synthesized using a reverse transcription kit (NucleoSpin®, MACHEREY-NAGEL GmbH & Co, Düren, Germany) from 4 µg total RNA. PCRs were performed with a Bio-Rad CFX96 Connect Real-time PCR System instrument and software (Bio-Rad Laboratories). Mouse primers for Tnf-α (Tnf-α), interleukin-1β (Il-1β), interleukin-10 (Il-10), and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as housekeeping genes were purchased from Qiagen, Hilden, Germany. Data were analyzed according to the 2−ΔΔCT method.
10
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse tissues and cultured cells were extracted with TRIzol reagent (Thermo Fisher Scientific), and total RNA concentration and quality was determined with a ND-1000 spectrophotometer (Nano Drop Technologies, Wilmington, DE, USA). cDNA was synthesized from 700 to 1,000 ng RNA using the QuantiTect Reverse Transcription kit (Qiagen, Manchester, UK) according to the manufacturer’s instructions. Real-time quantitative PCR was performed using either Taqman or Sybr Select gene expression master mix (Life Technologies) in the StepOnePlus™ thermal cycler (Applied Biosystems). Primers were purchased from Qiagen (tnfα, il-6, il-12b, ccl2, ccl5, cxcl1, fcγRI, icam-1, βactin) and Taqman (gpr84, βactin). Cycle threshold values were determined by the StepOne software and target gene expression was normalized to housekeeping gene (βactin). Relative expression results were plotted as mRNA expression divided by actin expression, and normalized to basal samples when convenient (24 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!