Tnf α
The TNF-α product is a laboratory equipment used for the detection and quantification of tumor necrosis factor alpha (TNF-α) in biological samples. It provides a reliable and sensitive method for measuring TNF-α levels, which is a key cytokine involved in various inflammatory and immune-related processes.
Lab products found in correlation
24 protocols using tnf α
Quantifying Hepatocyte Gene Expression
Measuring Gene Expression in Lung Tissue
Real-time PCR for TNFα and IL1β
Serum Cytokine Profiling by ELISA
Aortic Valve Gene Expression Analysis
Primers used:
BMP2: QT00012544 (Qiagen, Hilden, Germany)
BCl2: QT00156282 (Qiagen, Hilden, Germany)
Casp3: QT00260169(Qiagen, Hilden, Germany)
BGLAP: QT00259406 (Qiagen, Hilden, Germany)
RUNX2: QT00020517 (Qiagen, Hilden, Germany)
ALPL: QT00157717 (Qiagen, Hilden, Germany)
Wnt5a: QT00160958 (Qiagen, Hilden, Germany)
MMP9: QT00108815 (Qiagen, Hilden, Germany)
TIMP: forward 5‐tagtgatggttcccctcctc‐3, reverse 5‐tacttgtttgccatttccca‐3
AGRT1: QT00233548(Qiagen, Hilden, Germany)
TGFβ2: QT00058233 (Qiagen, Hilden, Germany)
TNFα: QT00115332(Qiagen, Hilden, Germany)
Kidney mRNA Expression Profiling via qPCR
Gene Expression Analysis of Intestinal Tight Junctions
Kidney mRNA Extraction and qPCR Analysis
Quantitative Analysis of Inflammatory Markers
RNA Extraction and qPCR Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!