Anti fade fluorescent mounting medium

Manufactured by Agilent Technologies

Sourced in United States

Anti-fade fluorescent mounting medium is a laboratory product used to preserve and protect fluorescent signals in microscopy samples. It helps prevent the fading or loss of fluorescence over time, allowing for longer observation and imaging of fluorescently labeled specimens.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Fluorescent mounting medium (661 citations) Mounting medium (231 citations) Anti-fade mounting medium (20 citations) Anti-fade medium (12 citations) Anti-TM (1 citations)

9 protocols using anti fade fluorescent mounting medium

Immunostaining and Imaging of NETosis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells that had been induced to produce NETs were fixed with paraformaldehyde (4% (w/v) for 10 min; 2% (w/v) onto 8-chamber slides (BD Falcon, New York, NY, USA) overnight, and immunostained with several NET markers. For MPO staining, mouse anti-myeloperoxidase antibody (ab25989, Abcam, Cambridge, MA, USA) at 1:500 dilution was used (with secondary antibody conjugated with a green fluorescence Alexafluor 488 dye; 1:2000 dilution; Thermo Fisher Scientific, Waltham, MA USA)) and DAPI (1:1000 dilution) was used to stain DNA. Eight-well chamber slides (Falcon culture slides) were used to obtain high-resolution images. Following immunostaining, the slides were mounted with anti-fade fluorescent mounting medium (Dako, Santa Clara, CA, USA) and glass cover slips (Fisher Scientific, Markham, ON, Canada)). NETosis was identified by MPO to NET DNA colocalization by an immunofluorescence confocal microscopy (Olympus IX81 inverted fluorescence microscope equipped with a Hamamatsu C9100-13 back-thinned EM-CCD camera and Yokogawa CSU × 1 spinning disk confocal scan head). The confocal images were taken at 40× magnification with 1.35× objective, and processed by Volocity software (Version 6.3, Cell Imaging Perkin-Elmer, Quorum Technologies Inc., Puslinch, ON, Canada).

Khan M.A., D’Ovidio A., Tran H, & Palaniyar N. (2019). Anthracyclines Suppress Both NADPH Oxidase- Dependent and -Independent NETosis in Human Neutrophils. Cancers, 11(9), 1328.

+ Open protocol

+ Expand

Immunohistochemical Analysis of Hsp70 and Caspase-3

Check if the same lab product or an alternative is used in the 5 most similar protocols

Paraffin-embedded tissue sections were deparaffinized with xylene and hydrated using graded percentages of alcohol. The tissues were then rinsed with 0.1 M PBS and deionized water several times. Subsequently, the sections were incubated with a 3% hydrogen peroxide solution in methanol for 15 min to quench endogenous peroxidase activity. The sections were incubated with a serum blocking solution for 1 h at 25°C. The sections were then incubated with anti-Hsp70 and anti-caspase-3 antibodies (Sigma-Aldrich Inc., St. Louis, MO, USA) at a 1:100 dilution in primary antibody dilution buffer for 2 h at room temperature, followed by overnight incubation at 4°C. After rinsing three times with 0.1 M PBS containing 0.5% Triton X-100, the sections were incubated with goat anti-rabbit HRP for 1 h at room temperature in a black box. The sections were then dehydrated using various grades of alcohol, washed, and mounted using anti-fade fluorescent mounting medium (Dako Cytomation, Carpinteria, CA, USA). Images were obtained using a microscope (Olympus BX63; Olympus Co., Tokyo, Japan) equipped.

Lee C.H., Su T.C., Lee M.S., Hsu C.S., Yang R.C, & Kao J.K. (2023). Heat shock protein 70 protects the lungs from hyperoxic injury in a neonatal rat model of bronchopulmonary dysplasia. PLOS ONE, 18(5), e0285944.

+ Open protocol

+ Expand

Autophagy Induction in Cervical Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human cervical carcinoma cells were seeded at 50% confluence on glass slides and incubated at 37 °C. When the density of cells reached 70–80%, the GFP-RFP-LC3 plasmid (Addgene, Watertown, MA, USA) was transfected using lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, lnc.) in accordance with the instructions of transfection reagent. New RPMI media containing 0.5% FBS was replaced after transfected for dd4 h. Subsequently, Cells were treated with indicated concentration of MAC and CQ. After treatment with these drugs for 24 h, cells were fixed using 100% methanol. Then, cells were stained with DAPI for 4 min before being covered with anti-fade fluorescent mounting medium (Dako). Fluorescent signals were visualized by an automated microscope (Biotek, Agilent Technologies, Santa Clara, CA, USA).

Cho Y., Jeong Y.J., Song K.H., Chung I.K., Magae J., Kwon T.K., Choi Y.H., Kwak J.Y, & Chang Y.C. (2022). 4-O-Methylascochlorin-Mediated BNIP-3 Expression Controls the Balance of Apoptosis and Autophagy in Cervical Carcinoma Cells. International Journal of Molecular Sciences, 23(23), 15138.

+ Open protocol

+ Expand

Fluorescent In Situ Hybridization of Retinal Glra2

Check if the same lab product or an alternative is used in the 5 most similar protocols

FISH assays were conducted using the Cy3-labelled cGlra2 probe and negative control probe. The Glra2 probe sequence: TCAGAAAAATGTTCACTCGGTAGTCCTTTGGCAGAGATGCCCTGGAACCT. The control probe sequence: AAACAGTACTGGTGTGTAGTACGAGCTGAAGCTAC. Briefly, retinal sections were fixed in 4% PFA for 1 h. Following fixation and washing with PBS, retinal sections were permeabilized with 0.5% Triton X-100 for 10 min and pre-hybridized with the pre-hybridization buffer (contain 1% blocking solution) for 30 min at 37°C. After washing with PBS three times for 5 min each time, retinal sections were incubated with the fluorescence probes in the hybridization buffer (40% formamide, 10% Dextran sulfate, 1 × Denhardt’s solution, 4 × SSC, 10 mM DDT, 1 mg ml⁻¹ yeast transfer RNA, 1 mg ml⁻¹ sheared salmon sperm DNA) at 37°C for 6 h. Afterwards, they were washed in the gradient decreased concentration of SSC buffer at 42°C (4 × SSC buffer for 5 min trice, 2 × SSC buffer for 5 min, 1 × SSC buffer for 5 min). Finally, they were incubated with 4, 6-diamidino-2-phenylindole (DAPI, D1306) for 10 min at room temperature to label the nuclei and mounted with the anti-fade fluorescent mounting medium (Dako).

Wang T., Li S., Li X.M., Li C., Wang F, & Jiang Q. (2023). Targeting circular RNA-Glra2 alleviates retinal neurodegeneration induced by ocular hypertension. Aging (Albany NY), 15(19), 10705-10731.

+ Open protocol

+ Expand

Immunofluorescence Analysis of NET Formation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells and NETs were fixed with paraformaldehyde (4% (w/v) for 10 min; 2% (w/v) for overnight), and immunostained with various NET markers. Mouse anti-myeloperoxidase antibody (ab25989, Abcam) at 1:500 dilution was used for staining MPO (with secondary antibody conjugated with a green fluorescence Alexa fluor 488 dye; 1:2000 dilution; ThermoFisher Scientific), while rabbit anti-citrullinated histone 3 antibody (ab5103, Abcam) at 1:500 dilution was used for detecting the presence of CitH3 (with secondary antibody conjugated with a far red fluorescence dye Alexa fluor 647; 1:1000 dilution; ThermoFisher Scientific). DNA was stained with DAPI (1:1000 dilution). To obtain high-resolution images, 8-well chamber slides (Falcon culture slides) were used. After completing the immunostaining, the slides were mounted with anti-fade fluorescent mounting medium (Dako) and glass cover slips (Fisher Scientific). True NETosis was confirmed by MPO colocalization to NET DNA by immunofluorescence confocal microscopy (Olympus IX81 inverted fluorescence microscope equipped with a Hamamatsu C9100-13 back-thinned EM-CCD camera and Yokogawa CSU × 1 spinning disk confocal scan head). The confocal images were taken at 40× magnification with 1.35× objective, and processed by Volocity software (version 6.3, Cell Imaging Perkin-Elmer).

Khan M.A, & Palaniyar N. (2017). Transcriptional firing helps to drive NETosis. Scientific Reports, 7, 41749.

+ Open protocol

+ Expand

Immunofluorescent Labeling of Nerve Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cryostat sections were exposed to 5% normal goat serum in 0.01 M PBS with 0.03% Triton X-100 at room temperature for 1 h prior to the primary antibody incubation. Nerve sections were incubated for 1 h at room temperature followed by overnight incubation at 4 °C with rabbit polyclonal antibodies against high molecular weight neurofilament (NF; 1:250, Millipore AB1991) to stain axons, mouse monoclonal antibodies against S100 (1:200, Millipore MAB079–1) combined with rabbit polyclonal antibodies against P75 (1:100, Millipore 07–476) to stain Schwann cells. After the primary incubation, nerve tissue sections were washed three times for 5 min with 0.01 M PBS (pH 7.4) and then incubated with goat anti-rabbit or goat anti-mouse antibodies coupled to AlexaFluor 488 or AlexaFluor 555 (1:500; Molecular Probes, Eugene, OR, USA) for 1 h at room temperature. Sections were then washed 3 times for 5 min with 0.01 M PBS (pH 7.4), counterstained with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride; ThemoFisher), rinsed twice more, and covered with glass slips with anti-fade fluorescent mounting medium (Dako, Carpenteria, CA, USA). For detection of myelinated axons, plastic sections were stained with toluidine blue, covered with glass slips with VectaMount mounting medium (Vector Laboratories, Burlingame, CA, USA).

Haggerty A.E., Bening M.R., Pherribo G., Dauer E.A, & Oudega M. (2019). Laminin polymer treatment accelerates repair of the crushed peripheral nerve in adult rats. Acta biomaterialia, 86, 185-193.

+ Open protocol

+ Expand

Immunostaining of Spinal Cord Sections

Check if the same lab product or an alternative is used in the 5 most similar protocols

For immunostaining, sections were permeabilized with 0.5% Triton X-100 in PBS, immune-blocked with 4% normal goat or donkey serum in PBS for 2 h, and then incubated with primary antibodies (Table S1) overnight at 4°C. After washing three times with PBS, sections were incubated for 2 hours with Cy5- or Cy3-conjugated secondary antibodies (1:200; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). Sections were washed three times with PBS, counterstained for 3 min at room temperature with the nuclear stain, DAPI (4’,6-Diamidino-2-Phenylindole Dihydrochloride, 2 μL/mL; Thermo Fisher), and covered with glass slips in anti-fade fluorescent mounting medium (Dako). Sections were stored at 4°C until analysis under a Zeiss LSM 510 Meta Confocal Microscope (Thornwood, NY). Regions of Interest (ROIs) were selected for quantification from tile scans of 3.5 mm-long spinal cord segment centered on the contusion.

Li X., Zhang C., Haggerty A.E., Yan J., Lan M., Seu M., Yang M., Marlow M.M., Maldonado-Lasunción I., Cho B., Zhou Z., Chen L., Martin R., Nitobe Y., Yamane K., You H., Reddy S., Quan D.P., Oudega M, & Mao H.Q. (2020). The Effect of a Nanofiber-Hydrogel Composite on Neural Tissue Repair and Regeneration in the Contused Spinal Cord. Biomaterials, 245, 119978.

+ Open protocol

+ Expand

Characterizing Infiltrated Cell Types in mfNHC Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

To determine the infiltrated cell type inside the mfNHC construct in-vivo, the following groups: mfNHC alone, mfNHC-MSC, and MSC suspension, were included. Different materials were injected subcutaneously on the dorsal side of the SD rats. Animals were sacrificed at predefined time point and the injections were retrieved, sectioned for immunofluorescent staining at POD 3, 14 and 28. The fixed collected tissues were sectioned and permeabilized with 0.5% Triton X-100 in PBS, immune-blocked with 4% donkey serum for 2 h, and then incubated with primary antibodies (Table S1 in supporting information) overnight at 4 °C. After washing three times with PBS, tissue sections were incubated for 2 h with Cy5-or Cy3-conjugated secondary antibodies (Table S2 in supporting information), washed three times with PBS, counterstained for 10 min at room temperature with the nuclear stain, DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, 2 μg mL⁻¹; Thermo Fisher), and mounted with glass slips in anti-fade fluorescent mounting medium (Dako). Sections were stored at 4 °C until analysis under a Zeiss LSM 510 Meta Confocal Microscope.

Yao Z.C., Yang Y.H., Kong J., Zhu Y., Li L., Chang C., Zhang C., Yin J., Chao J., Selaru F.M., Reddy S.K, & Mao H.Q. (2022). Biostimulatory Micro-fragmented Nanofiber-Hydrogel Composite Improves Mesenchymal Stem Cell Delivery and Soft Tissue Remodelling. Small (Weinheim an der Bergstrasse, Germany), 18(36), e2202309.

+ Open protocol

+ Expand

GFP-Parkin Recruitment to Mitochondria

Check if the same lab product or an alternative is used in the 5 most similar protocols

U2OS GFP-Parkin cells were grown overnight in Nunc Lab-Tek II 8-well chamber slides (Thermo Fisher Scientific) before transfection with dsRed, or FlagBAG5. At 24 h post transfection, cells were treated with 20 μm carbonyl cyanide m-chlorophenyl hydrazone (CCCP) (Sigma Aldrich) for 1 h. Cells were fixed in 4% paraformaldehyde, permeabilized in 0.2% Triton X-100 in phosphate-buffered saline (PBS), and blocked in 5% bovine serum albumin in PBS at room temperature. Cells were incubated overnight at 4 °C with primary antibodies for Flag (M2, Sigma, 1:1000) and TOM20 (Abcam, 1:1000) and then with Alexa Fluor conjugated secondary antibodies (Thermo Fischer Scientific, 1:1000) for 1 h at room temperature. DAPI was incorporated into the final PBS wash at a final concentration of 300 nm. Cells were coverslipped with anti-fade fluorescent mounting medium (Dako). Images were acquired using an LSM 880 laser scanning confocal microscope (Zeiss) using a × 20, 0.75 NA, or × 63, 1.42 NA, lens (Advanced Optical Microscopy Facility at Wright Cell Imaging Facility). GFP-Parkin recruitment to mitochondria was quantified by the visualization of punctate GFP-Parkin that colocalized with the mitochondria marker, TOM20.

De Snoo M.L., Friesen E.L., Zhang Y.T., Earnshaw R., Dorval G., Kapadia M., O’Hara D.M., Agapova V., Chau H., Pellerito O., Tang M.Y., Wang X., Schmitt-Ulms G., Durcan T.M., Fon E.A., Kalia L.V, & Kalia S.K. (2019). Bcl-2-associated athanogene 5 (BAG5) regulates Parkin-dependent mitophagy and cell death. Cell Death & Disease, 10(12), 907.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!