RT-PCR was used to determine whether the MYB-NFIB fusion gene was expressed. Total RNA was isolated from cells and reverse transcription was performed using a random primer and Omniscript (Qiagen, Hilden, Germany) according to the instructions provided with the kit. MYB-NFIB fusions were amplified by PCR using total cDNA and MYB primers for exon 5 (5′ GGCAGAAATCGCAAAGCTAC 3′), exon 6 (5′ CTCCGCCTACAGCTCAACTC 3′), or exon 14 (5′ GCACCAGCATCAGAAGATGA 3′) paired with a NFIB exon 9 primer (5′ GTGCTGCAATTGCTGGTCTA 3′). The PCR products were gel purified and sequenced in both directions using MYB and NFIB primers.
For protein expression, total cell lysates were prepared using 300 μl of 2x Laemmli buffer to collect the ACC11 cells followed by heating at 95 °C for 10 min. Thirty micrograms of total protein was loaded on a 4–12% gradient Bis-Tris gel (Novex), transferred to a nitrocellulose membrane and probed with anti-Myb antibody (Abcam, Cambridge, UK). Myb protein levels were visualized using a chemiluminescent reagent (Pierce, Massachusetts, USA).
For protein expression, total cell lysates were prepared using 300 μl of 2x Laemmli buffer to collect the ACC11 cells followed by heating at 95 °C for 10 min. Thirty micrograms of total protein was loaded on a 4–12% gradient Bis-Tris gel (Novex), transferred to a nitrocellulose membrane and probed with anti-Myb antibody (Abcam, Cambridge, UK). Myb protein levels were visualized using a chemiluminescent reagent (Pierce, Massachusetts, USA).