Abi prism 3700 dna analyzer

Bacterial DNA was extracted from 31 selected colonies using the ISOLATE II Genomic DNA Kit (Bioline, London, UK) following the manufacturer’s instructions. Polymerase chain reaction (PCR) was done using Go Taq Master Mix (Promega, Wisconsin, USA). A final PCR reaction volume of 25 μl was prepared by adding 12.5 μl of Go Taq Master Mix, 9.5μl nuclease-free water, 0.3 μl each of the forward and reverse primers, and 2 μl of the bacterial DNA template. The PCR reaction was set in an ABI GeneAMP 9700 (Applied Biosystem, Foster City, CA, USA) as follows: 95°C for 5min, 35 cycles (94°C for 30 sec, 57°C for 45 sec, 72°C for 45 sec), followed by a final extension for 7 mins at 72°C. The quality of the amplicons was done using gel electrophoresis in 1.5% w/v agarose gel before purification and sequencing. Each of the cleaned amplicons (using Exonuclease I and Shrimp Alkaline Phosphatase or ExoSAP-IT) were bi-directionally sequenced using BigDye^® Terminator v3.1 Sequencing Standard kit on ABI PRISM^® 3700 DNA Analyzer (Applied Biosystems, Foster City, CA, USA).

Genomic DNA (500 ng) was bisulfite converted using EZ DNA Methylation-Lightning Kit (Zymo Research). PCR primers used were xSatI-Bis1 GTTAATATTAATTTGAGGTTTAG; xSatI-Bis2 GTTTGAATAGTTTAGTTGGTAG; xSatI-Bis3 AAATACTAAATAAAAAAACCC; xSatI-Bis4 TTCAAACTAATACTAAACAAAC. PCR products were cloned into pGEM-T Easy (Promega) and sequenced using BigDye 3.1 sequencing chemistry (Thermo Fisher Scientific) on an ABI Prism 3700 DNA Analyzer (Applied Biosystems).

Classical Sanger sequences were performed for the following genes: TP53 (exons 4 to 10; n = 45 cases), PIK3CA (exons 8, 10 and 21; n = 39 cases), SEC63 (exons 1 to 21; n = 43 cases) and FOXO3 (exons 2 to 4; n = 51 cases). Each PCR was performed on 30 ng of tumour DNA (TP53 and PIK3CA) or cDNA (SEC63 and FOXO3). These genes were PCR-amplified and bidirectionally sequenced using BigDye Terminator chemistry (Applied Biosystems) with an ABI PRISM 3700 DNA Analyzer. The primer sequences are available in Additional file 2: Table S6. The functional impact of change in amino acids was determined on the basis of scoring using the PolyPhen-2 tool [23 (link)].

Direct sequencing of the PCR products was performed with reagents and an analyzer (Big Dye Terminator Cycle Sequencing and ABI PRISM 3700 DNA Analyzer; Applied Biosystems).

Total RNA was extracted from bat cell lysates using RNeasy Mini Spin Column (QIAgen). cDNA was PCR amplified with primers, 5′-GTCACCAGAGGGTCATAAA-3′ and 5′-CCACTTCCTCTGCCATCAAA-3′. The PCR mixture (25 μl) contained cDNA, PCR buffer, 200 μM (each) dNTPs, and 1.0 U Iproof Polymerase (Bio-Rad, Hercules, CA, USA). The mixtures were amplified for 40 cycles of 98 °C for 10 s, 55 °C for 30 s, and 72 °C for 72 s and a final extension at 72 °C for 10 min in an automated thermal cycler (Applied Biosystems, Foster City, CA, USA). RT-PCR products were gel purified using QIAquick gel extraction kit (Qiagen), and sequenced with an ABI Prism 3700 DNA Analyzer (Applied Biosystems). The sequences obtained were compared with sequences of DPP4 genes in GenBank database. Phylogenetic tree construction was performed based on an amino acid alignment of partial DPP4 sequences (corresponding to residue 229–346 of hDPP4) using the Neighbor-Joining method with JTT model by MEGA 6.0, with bootstrap values calculated from 1000 trees.

Targeted Sanger sequencing was performed on DNA samples of all family members subjected to genetic testing to confirm WGS results. Primers for amplification and sequencing were designed for the region of 460 bp using Primer-BLAST software⁸ (Ye et al., 2012 (link)). The PCR was performed in a total volume of 25 μl using the containing 5 μl of Q5^® Reaction Buffer (New England Biolabs, NEB), 5 μl of Q5^® High GC Enhancer (NEB), 1.25 μl of forward (5’ CCTCCTACAAGCCTCAGACG 3’) and reverse primer (5’ ACATGCCCTGGAACATCACG 3’) each (10 μmol/l), 0.5 μl of dNTP mix (10 μmol/l each), 0.25 μl of Q5^® High-Fidelity DNA Polymerase (NEB), 2 μl of genomic DNA (50 ng/μl) and 9.75 μl of deionized water. PCR conditions were as follows: initial denaturation at 98°C for 30 s followed by 35 cycles (denaturation at 98°C for 10 s, annealing at 58°C for 20 s, elongation at 72°C for 20 s) and final elongation at 72°C for 5 min. Sequencing of PCR products was carried out using dye-terminator chemistry (kit v.3, ABI 3130XL) and run on automated sequencer ABI Prism 3700 DNA Analyzer (Applied Biosystems).