U251 and SW1088 cells (ATCC) were grown in DMEM supplemented with 10% fetal bovine serum (Sigma Aldrich) in a humidified atmosphere of 5% CO2 at 37 °C. Short hairpin RNA (shRNA) targeting CRNDE or scramble shRNA (Genechem) was cloned into lentiviral vectors, followed by transfection into U251 and SW1088 cells for 3 days and exposure to 4 μg/mL puromycin for one week.
Scramble shrna
Manufactured by Genechem
Sourced in China
Scramble shRNA is a laboratory tool used to generate a non-targeting control shRNA sequence. It serves as a negative control to evaluate the efficacy and specificity of shRNA-mediated gene knockdown experiments.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Merck Group (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Shrna 1, by GenePharma (1 mentions)
Shrna2, by GenePharma (1 mentions)
Scramble shrna, by GenePharma (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Shrna, by GenePharma (1 mentions)
Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Eclipse ti, by Nikon (1 mentions)
Puromycin, by Solarbio (1 mentions)
8 protocols using scramble shrna
1
CRNDE Silencing in Glioma Cells
2
TRIM22 and NF-κB-p65 Knockdown Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids encoding human TRIM22 shRNA, NF-κB-p65 (RelA) shRNA and scramble shRNA were purchased from Shanghai Genechem Co., Ltd. A human NF-κB-p65 shRNA plasmid, resistant to puromycin, was selected to knockdown NF-κB-p65 expression (shR p65); the TRIM22 shRNA plasmid was then used to knockdown the expression of TRIM22 (shR TRIM22). TRIM22 OE Ishikawa cells (2×105) and cells expressing relatively high levels of TRIM22 (TRIM22 RL-952 cells; 2×105) were seeded into 6-well plates and cultured at 37°C in a humidified 5% CO2 atmosphere overnight. The following day, the cells were incubated with the transfection medium containing the shRNA plasmid and Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) for 5-7 h, after which the transfection medium was replaced with normal growth medium for incubation of the cells for a further 48 h at 37°C in a humidified 5% CO2 atmosphere. The NF-κB-p65 (RelA) shRNA target sequence was: 5'-CTCCATTGCGGACATGGACTT-3'; shRNA non-target sequence: 5'-TTCTCCGAACGTGTCACGT-3'; TRIM22 shRNA target sequence: 5'-CCAGATATAGACCTCAATA-3'; and TRIM22 shRNA non-target sequence: 5'-TTC TCCGAACGTGTCACGT-3'.
3
GATA3 Silencing in RAW264.7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GATA3-shRNA and scramble-shRNA were synthesized by Shanghai Genechem Co., Ltd., (Shanghai, China). RAW264.7 cells were transfected with GATA3-shRNA using lipofectamine 2000 as previously described.(Hernandez-Alejandro et al, 2012 (link)) The scramble-shRNA transfected cells were used as controls.
4
Silencing GLP-1R in PC12 cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ShRNA-GLP-1R or Scramble shRNA were obtained from GeneChem (Shanghai, China). PC12 cells (1.0 × 106) were transfected with 4 µg of shRNA-GLP-1R or Scramble shRNA by using Lipofectamine 2000.
5
Lentiviral Knockdown and Overexpression of MEOX2 in Glioma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral expression MEOX2-shRNA, Scramble-shRNA, MEOX2, CT SS, and Empty Vector (EV) were constructed from Genechem (Shanghai, China). The shMEOX2 sequence was designed according to the siMEOX2 targeting sequence #2. GSC23 cells were utilized to create a stable MEOX2 knockdown cell line, whereas U87 and GSC91 cells were used to create stable MEOX2 overexpression cell lines. GSC23 or GSC91 cell spheres were trypsinized into individual cells and then plated on 24-well Matrigel pre-coated plates, while U87 cells were directly plated in 24-well plates. Lentiviruses transfection was performed using polybrene according to the manufacturer’s instructions. After 48 h of transfection, the cells were screened with 5 µg/mL puromycin (MCE, USA) for 2 weeks to obtain a stable cell line, and qRT-PCR and immunoblot were used to detect transfection efficiency.
6
Silencing hTERT Expression in Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two short hairpin RNAs (shRNAs) specifically targeting the hTERT (shRNA1, GCATTGGAATCAGACAGCACT (sense), shRNA2, TGAGGCCTGAGTGAGTGTTTG (sense)), and a scramble shRNA (GACCTGTACGCCAACACAGTG (sense)) were synthesized by Genepharma (Shanghai, P. R. China). The hTERT shRNA and scramble shRNA sequences were each cloned into the pGCsilencer expressing plasmid (Genechem, Shanghai, P. R. China) and transiently transfected into CAPAN-2 and CAL-27 cells for 48 h using Lipofectamine 2000 reagent (Invitrogen, USA) following the manufacturer's instructions.
7
Stable Cell Line Construction for PCNP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCNP expression plasmid and empty vector, the PCNP shRNA (sh‐PCNP group) and scramble shRNA (sh‐Scb group) were purchased from Genechem (Shanghai, China) and were transfected into OC cells with Lipofectamine 3000 Transfection Reagent (Invitrogen, Shanghai, China) to construct stable cell lines. They were screened, respectively, by G418 (Solarbio, Shanghai, China) at a concentration of 800 μg/mL and puromycin (Solarbio, Shanghai, China) at a concentration of 2 μg/mL. The un‐transfected tumour cells were used as controls. Seventy‐two hours post‐transfection, the localization of PCNP within tumour cells was detected under a fluorescent microscope (Eclipse Ti, Nikon, Melville, NY, USA).
8
Generating Stable PHF20 Knockdown Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentivirus vector GV493-green fluorescent protein (GFP) containing scramble shRNA (Scr) or shRNA targeting PHF20 (shPHF) were obtained from Shanghai Genechem Co., Ltd. The target sequence was 5′-CCA GCT CAC ATA GAA GAC ATT-3′. A random Scr sequence, 5′-GTT CTC CGA ACG TGT CAC GT-3′, was used as a negative control. FaDu cells were seeded in 6-well plates at the density of 1×105/ml for 24 h, and were infected with shPHF20 or Scr (MOI=10) for 16 h at 37°C. Subsequently, puromycin (cat. no. A610593-0025; Sangon) was added to the culture medium at 37°C with 5% CO2 for ~14 days according to the manufacturer's instructions to generate stable FaDu PHF20-knockdown cell lines. The lentiviral infection efficiency was determined by fluorescence microscopy and western blot assay.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!