Precellys system

Manufactured by Bertin Technologies

Sourced in France

The Precellys system is a high-performance homogenizer designed for efficient tissue and cell sample preparation. It utilizes bead-beating technology to disrupt samples and extract biomolecules for further analysis.

Automatically generated - may contain errors

Lab products found in correlation

Nucleospin rna 2 kit, by Macherey-Nagel (2 mentions) Nucleomag pathogen kit, by Macherey-Nagel (2 mentions) Nucleomag rna kit, by Macherey-Nagel (2 mentions) Precellys lysing kit tubes, by Bertin Technologies (2 mentions) Nucleospin rna virus kit, by Macherey-Nagel (2 mentions) Kingfisher flex purification system, by Thermo Fisher Scientific (2 mentions) Nanodrop nd 100, by Thermo Fisher Scientific (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Nucleospin 96 rna kit, by Macherey-Nagel (1 mentions) Applied biosystems 7500 fast thermocycler, by Thermo Fisher Scientific (1 mentions) Superscript 4 rt, by Thermo Fisher Scientific (1 mentions) Oligo dt, by Thermo Fisher Scientific (1 mentions) Lightcycler 480 real time pcr system, by Roche (1 mentions) Nucleospin rna kit, by Macherey-Nagel (1 mentions) Maldi tof mass spectrometry, by Bruker (1 mentions) Sds page, by Bio-Rad (1 mentions) Anti actin antibody, by Merck Group (1 mentions) Granada medium, by bioMérieux (1 mentions) Todd hewitt medium, by BD (1 mentions)

Spelling variants of this product

Precellys 24 system (5 citations) Precellys tissue homogenizer system (3 citations) Precellys Evolution system (3 citations) Precellys 24 homogenizer system (2 citations) Precellys 24 lysing system (2 citations) Precellys Bead Beating system (2 citations) Precellys 24 lysis and homogenization system (2 citations) Precellys homogenizer system (2 citations)

11 protocols using precellys system

Quantitative RT-PCR for RRV Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

20 µL of blood were used for RNA extraction using the Nucleospin 96 RNA kit (Macherey Nagel) according to the manufacturer’s instructions.
Tissues samples collected and frozen at −80 °C, were weighed and grinded in Macherey Nagel RA1 Lysis buffer with a Precellys system^® and ceramic beads tubes, Bertin technologies (Montigny Le Bretonneux, France). Total RNA was extracted using Nucleospin RNA II kit (Macherey Nagel) according to manufacturer’s instructions.
Quantitative reverse transcriptase polymerase chain reactions (qRT-PCR) were performed in an Applied Biosystems 7500 fast thermocycler (ThermoFisher Scientific). The sequences of the primers (400 nM) and probe (200 nM) are the following:
RRV-F (position 10407): AGCAACAATCAGGATCAGTTAT;
RRV-R (position 10616): AATCTACCCGGCTGGCCTG;
RRV-Probe (position 10511): [FAM]TCTCAACAGCTTGGTCACCGTT [TAM].
qRT-PCR was performed on 5 µL of the extracted RNA with the following cycling conditions: 30 min at 56 °C, 5 min at 95 °C and 40 cycles at 95 °C for 15 s, 60 °C for 1 min.

Belarbi E., Legros V., Basset J., Desprès P., Roques P, & Choumet V. (2019). Bioluminescent Ross River Virus Allows Live Monitoring of Acute and Long-Term Alphaviral Infection by In Vivo Imaging. Viruses, 11(7), 584.

+ Open protocol

+ Expand

Lipid Extraction from Spinal Cord and Muscle

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tissue samples (25 mg for lumbar spinal cord, and 25–50 mg for soleus muscle) were gently thawed on crushed ice and homogenized with 335 µl precooled methanol. Lipids were extracted by orbital agitation using a Precellys system (Bertin Technologies, Saint-Quentin-en-Yvelines, France) in a propylene tube containing ceramic beads. Two homogenization steps at 5000 rpm for 30 s each were performed at room temperature. Homogenates were transferred into glass conic tubes. To recover the maximum volume of homogenate, Precellys tubes, beads and tips were washed with additional 335 µl precooled methanol. Then, homogenates were mixed with 1340 µl chloroform and centrifuged at 2000 rpm for 5 min at 4°C. The organic phase was transferred into a conical glass tube and washed with 400 µl precooled 0.9% NaCl. After centrifugation at 2000 rpm for 5 min at 4°C, the organic phase was evaporated to dryness at 30°C under nitrogen. Residues were reconstituted with acetonitrile/isopropanol (1:1) (100 µl for lumbar spinal cord, and 60 µl for soleus muscle) and further diluted with solvent mixture before injection (1/40 for lumbar spinal cord, and 1/10 for soleus muscle).

Henriques A., Croixmarie V., Priestman D.A., Rosenbohm A., Dirrig-Grosch S., D'Ambra E., Huebecker M., Hussain G., Boursier-Neyret C., Echaniz-Laguna A., Ludolph A.C., Platt F.M., Walther B., Spedding M., Loeffler J.P, & Gonzalez De Aguilar J.L. (2015). Amyotrophic lateral sclerosis and denervation alter sphingolipids and up-regulate glucosylceramide synthase. Human Molecular Genetics, 24(25), 7390-7405.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small intestine (duodenum to ileum) was homogenized in 7 mL tubes containing a mix of 1.4 and 2.8 mm glass beads and 2 mL Trizol (ThermoFisher), respectively using the Precellys system (Bertin Technologies). RNA extraction from organs and cultured cells, RNA clean-up and DNase treatment were performed using the Nucleospin RNA kit (Macherey-Nagel) according to the manufacturer’s instructions.
RNA was quantified using the NanoDrop ND-100 (ThermoFisher) and cDNA synthesis was performed from 1 μg of RNA using oligo-dT (ThermoFisher) and SuperScript IV RT (ThermoFisher). RT-qPCR was performed using Power SYBR Green PCR system (ThermoFisher) and specific primers listed in Supplementary file 1 on the LightCycler 480 Real-Time PCR System (Roche). Relative quantification of gene expression was performed using the comparative 2^-ΔΔCt method. Results were normalized using Actin as the housekeeping gene.

Hays C., Touak G., Bouaboud A., Fouet A., Guignot J., Poyart C, & Tazi A. (2019). Perinatal hormones favor CC17 group B Streptococcus intestinal translocation through M cells and hypervirulence in neonates. eLife, 8, e48772.

+ Open protocol

+ Expand

Bacterial Identification from Stool and Ileum

Check if the same lab product or an alternative is used in the 5 most similar protocols

Stool samples and ileum were homogenized in 2-ml tubes containing a mixture of 1.4-mm-diameter and 2.8-mm-diameter glass beads and 1 ml sterile water using a Precellys system (Bertin Technologies). Serial dilutions were plated on selective media (see the supplemental material) for bacterial identification by matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) mass spectrometry (Bruker) and CFU counts.

Tazi A., Araujo J.R., Mulet C., Arena E.T., Nigro G., Pédron T, & Sansonetti P.J. (2018). Disentangling Host-Microbiota Regulation of Lipid Secretion by Enterocytes: Insights from Commensals Lactobacillus paracasei and Escherichia coli. mBio, 9(5), e01493-18.

+ Open protocol

+ Expand

Efficient Viral and Bacterial Nucleic Acid Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA and bacterial DNA were extracted from 170-μl amounts of nasal swab, raw BAL fluid, and fecal swab samples using the NucleoMag pathogen kit (Macherey-Nagel, Germany) on the KingFisher Flex purification system (Thermo Fisher Scientific, MA, USA) according to the manufacturer’s instructions. Total RNA was extracted from pelleted cells of BAL fluid samples with the NucleoMag RNA kit (Macherey-Nagel, Germany) on the KingFisher Flex purification system (Thermo Fisher Scientific, MA, USA). Extraction of viral RNA and bacterial DNA from tissues (30-mg amounts of nasal turbinate, trachea, and lung lobe samples) were obtained by lysis in Precellys lysing kit tubes (catalog number P000912-LYSKO-A; Bertin Technologies, France) with 500 μl of Opti-MEM on a Precellys system (Bertin Technologies, France). Nucleic acids were then extracted using the NucleoSpin RNA virus kit (Macherey-Nagel, Germany).

Lion A., Secula A., Rançon C., Boulesteix O., Pinard A., Deslis A., Hägglund S., Salem E., Cassard H., Näslund K., Gaudino M., Moreno A., Brocchi E., Delverdier M., Zohari S., Baranowski E., Valarcher J.F., Ducatez M.F, & Meyer G. (2021). Enhanced Pathogenesis Caused by Influenza D Virus and Mycoplasma bovis Coinfection in Calves: a Disease Severity Linked with Overexpression of IFN-γ as a Key Player of the Enhanced Innate Immune Response in Lungs. Microbiology Spectrum, 9(3), e01690-21.

+ Open protocol

+ Expand

Synaptophysin expression in rat atrium

Check if the same lab product or an alternative is used in the 5 most similar protocols

The right atria were homogenized in ice-cold RIPA buffer supplemented with protease inhibitors (AEBSF, 2 mM; aprotinin, 0.3 μM; bestatin, 130 μM; E-64, 14 μM; leupeptin, 1 μM) using the Precellys system (Bertin Technologies, France). Proteins (10 μg) were separated on a 4-15% SDS-PAGE (Biorad, Denmark) and blotted onto hybond-P polyvinylidene fluoride transfer membranes (Amersham Biosciences, Denmark). Membranes were incubated with anti-synaptophysin antibody (0.2 μg/ml, Santa Cruz Biotechnology, USA). Synaptophysin is essential for synaptic vesicle regulation neurons and is a marker of nerve synapses. Immunoreactive proteins were detected by HRP-linked donkey anti-rabbit antibody (8 ng/ml, Jackson Immunosearch Laboratories, UK). Membranes were stripped and re-probed with anti-actin antibody (MAB1501, Millipore, Denmark). Protein band density was quantified as a Gaussian densiometric trace on the exposed films and processed equally. Immunoblotting was repeated three times and the average ratio of Synaptophysin/Actin bands density was calculated for each sample and used for the comparison between groups.

Soltysinska E., Speerschneider T., Winther S.V, & Thomsen M.B. (2014). Sinoatrial node dysfunction induces cardiac arrhythmias in diabetic mice. Cardiovascular Diabetology, 13, 122.

+ Open protocol

+ Expand

Pneumonia Induction Protocol in Mice

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For induction of pneumonia (Inoshima et al., 2011 (link); Popov et al., 2015 (link)), centrifuged bacteria (see above) were resuspended in endotoxin-free PBS at a density of approximately 10¹⁰ CFUs/ml (for experiments performed at Stanford University) or approximately 2x 10⁹ CFUs/ml (for experiments performed at the Medical University of Vienna) – the different inoculates of bacteria used were applied due to differing susceptibilities of wildtype mice in pilot experiments (data not shown), which might be explained by differences in housing conditions or microbiome composition. Anesthetized mice were intranasally inoculated with 30 μl in the left nostril (to achieve inoculates of approximately 3x 10⁸ or 6x 10⁷ CFUs/mouse, respectively). Body temperature was measured using a rectal thermometer.
Tissues for bacterial quantification, RNA and protein analysis were homogenized using the Precellys system (Bertin Instruments).

Starkl P., Watzenboeck M.L., Popov L.M., Zahalka S., Hladik A., Lakovits K., Radhouani M., Haschemi A., Marichal T., Reber L.L., Gaudenzio N., Sibilano R., Stulik L., Fontaine F., Mueller A.C., Amieva M.R., Galli S.J, & Knapp S. (2020). IgE effector mechanisms, in concert with mast cells, contribute to acquired host defense against S. aureus. Immunity, 53(4), 793-804.e9.

+ Open protocol

+ Expand

Quantifying Intratissular Bacteria

Check if the same lab product or an alternative is used in the 5 most similar protocols

Organs were homogenized in 2 mL (brain, spleen, intestine, Peyer’s patches, MLN) or 7 mL tubes (liver) containing a mix of 1.4 and 2.8 mm glass beads and sterile water using the Precellys system (Bertin Technologies). For quantification of intratissular bacteria, small intestine and Peyer’s patches were treated with 200 mg/L gentamicin for 2 hr at room temperature to kill extratissular bacteria before being washed three times in PBS and homogenized. Cultured cells were lysed with ice-cold water.
Serial dilutions were plated on Todd Hewitt medium (Becton Dickinson), and on Granada medium (bioMérieux) for intestine, Peyer’s patches, and MLN. Plates were incubated 24 hr at 37°C in aerobic (Todd Hewitt medium) or anaerobic (Granada medium) atmosphere.

+ Open protocol

+ Expand

Efficient RNA Extraction from Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Distal jejunum and liver left lobe were homogenized in 2-ml and 7-ml tubes containing a mix of 1.4-diameter and 2.8-mm-diameter glass beads and 1 ml and 2 ml Trizol, respectively, using a Precellys system (Bertin Technologies). RNA extractions from organs and cultured cells were performed using a NucleoSpin RNA II kit (Macherey-Nagel) before cDNA synthesis and RT-qPCR were performed with the primers listed in Table S6 in the supplemental material.

+ Open protocol

+ Expand

Efficient Viral and Bacterial Nucleic Acid Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!