In order to detect human herpesviruses in DNA extracts from CVL specimens, we adapted a PCR assay first published by Johnson, et. al [14 (link)]. The assay targets a region of the viral DNA polymerase gene that is widely conserved across the human herpesvirus family. Five microliters (5μL) of DNA extract was amplified in a PCR reaction consisting of 1μM forward (HSV-P1) and reverse (HSV-P2) primers, 250 μM dNTP mix, 1.5 mM MgCl2, and 2.5 units AmpliTaq Gold (Roche Molecular Systems). Reactions were conducted at 94°C for one minute, 60°C for 30 seconds, and 72°C for one minute, for a total of 40 cycles. Amplicons were digested with BamH1 and BstU1 restriction endonucleases and visualized by agarose gel electrophoresis with ethidium-bromide staining. The specific human herpesvirus detected was determined based on unique banding patterns as described in Johnson, et. al [14 (link)].
Amplitaq gold
Manufactured by Roche
Sourced in United States
AmpliTaq Gold is a DNA polymerase enzyme used in the polymerase chain reaction (PCR) process. It is designed for robust and reliable DNA amplification. AmpliTaq Gold provides reliable performance in a wide range of PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Oragene dna self collection kit, by DNA Genotek (1 mentions)
Abi prism 3730, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna blood mini kit, by Qiagen (1 mentions)
Geneamp pcr system 9700, by Thermo Fisher Scientific (1 mentions)
Rox dye, by Thermo Fisher Scientific (1 mentions)
Mgcl2, by Roche (1 mentions)
Pcr buffer 2, by Roche (1 mentions)
G1471, by Promega (1 mentions)
Dnazol, by Thermo Fisher Scientific (1 mentions)
Abi 310, by Thermo Fisher Scientific (1 mentions)
Microspin column, by GE Healthcare (1 mentions)
Kod fx, by Toyobo (1 mentions)
Bigdye terminator kit, by Thermo Fisher Scientific (1 mentions)
Qiamp viral rna kit, by Qiagen (1 mentions)
Abi prism 3100, by Thermo Fisher Scientific (1 mentions)
Lightcycler faststart dna master hybridization probes kit, by Roche (1 mentions)
Smitest ex r d, by Medical & Biological Laboratories (1 mentions)
12 protocols using amplitaq gold
1
PCR Assay for Human Herpesviruses
2
DNA Extraction and Genotyping Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated from peripheral leukocytes or saliva, using the QIAamp DNA Blood Mini Kit (Qiagen) and Oragene DNA Self Collection Kits (DNA Genotek) according to the manufacturers' instructions. The coding exons with known SNPs from deep sequencing were amplified by PCR in a total volume of 20 µl with 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 200 µM of dNTPs, and 0.2 µM of primers. 1 U of Ampli-Taq Gold (Roche) and 20 ng of genomic DNA were added. PCR reactions were performed on the GeneAmp PCR System 9700 (Applied Biosystems) with denaturation at 94°C for 10 min, and then denaturation at 94°C for 15 sec, annealing at 60°C for 30 sec, and elongation at 72°C for 1 min for a total of 35 cycles and a final elongation for 10 min at 72°C. The amplicons were purified by ExoSAP-IT and sequenced with the ABI PRISM 3730 (Applied Biosystems). The sequences of PCR primers are available upon request. Genomic and amino acid sequences for candidate genes were collected from Ensemble.
3
Detection of HPyV6 in Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was performed with 150 ng of genomic DNA using the AmpliTaq Gold (Roche) DNA polymerase in a final volume of 50 μl. For detection of HPyV6, primer sets and PCR conditions were used as described earlier [14 (link)]. Water instead of DNA template was used for PCR-negative controls containing all other PCR components.
4
Quantifying Mitochondrial DNA Copy Number
5
PCR Protocol for MCPyV Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was performed with 150 ng of genomic DNA using the AmpliTaq Gold (Roche) DNA polymerase in a final volume of 50 μl. For MCPyV detection we used the VP1 and M1M2 primer sets and PCR conditions as published earlier (Feng et al., 2008 (link); Kassem et al., 2008 (link)). Negative controls with water instead of patient samples were included in each amplification series.
6
HIV-1 pol Gene Sequencing from PBMC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole blood samples from patients failing first and second line ART were obtained and separated to obtain Peripheral blood mononuclear cells (PBMCs) by Ficoll-Hypaque density gradient centrifugation. Proviral DNA was extracted from the PBMCs using DNAzol (GIBCO BRL, Life Technologies) lysis and ethanol precipitation. Nested polymerase chain reaction (PCR) was performed using AmpliTaq Gold (Roche Molecular Systems, Branchburg, NJ). Briefly, HIV- 1 pol gene was amplified using the primers (RT18:5′GGAAACCAAAAATGATAGGGGGAATTGGAGG3′ and RT21 5′ CTGTATTTCTGCTATTAAGTCTTTTGATGGG 3′) and second round primers (RT 1: 5′ CCAAAAGTTAAACAATGGCCATTGACAGA 3′ and RT4: 5′ AGTTCATAACCCATCCAAAG 3′) in the second round
[15 (link)]. Amplification was achieved using 1 cycle of 95°C for 10 min and 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 1 min, with a final extension of 72°C for 10 min
[3 (link)] PCR amplification was confirmed by visualization with ethidium bromide staining of the gel. Positive generated amplicons were then directly sequenced using Big Dye technology on ABI 310 (Applied Biosystems, Foster City, CA)
[16 ].
[15 (link)]. Amplification was achieved using 1 cycle of 95°C for 10 min and 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 1 min, with a final extension of 72°C for 10 min
[3 (link)] PCR amplification was confirmed by visualization with ethidium bromide staining of the gel. Positive generated amplicons were then directly sequenced using Big Dye technology on ABI 310 (Applied Biosystems, Foster City, CA)
[16 ].
7
PCR-based Genotyping of Mutant Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genotyping of the offspring mice was performed as follows. Briefly, PCR was performed by AmpliTaq Gold (Roche) according to the manufacturer's protocol. A shared primer number 3 (5′- GTGAGTCTGGCTTCATGTG -3′) was designed downstream of the deleted region. This primer can pair with wt allele-specific primer number 2 (5′- CTATGTGGCCTTGGTCCAC -3′) to amplify a 320 bp PCR product or with the targeted allele-specific primer number 1 (5′- GCAGCGCATCGCCTTCTATC -3′) in the neo cassette to amplify a 650 bp fragment from the mutant allele. PCR products were resolved on 1% agarose gel.
8
HHV-6B Genome Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To reveal the contents of the HHV genome in the HUV-EC-C genome, PCR was performed on 15 regions (Fig. 1 ) using AmpliTaq Gold (Roche Indianapolis, IN, USA) or KOD FX (TOYOBO, Osaka, Japan) DNA polymerase. Primers were designed based on the HHV-6B HST reference sequence using a gene analysis software, Genetyx, listed in Table S2. The PCR products were run on a 2% agarose gel. A single band of the PCR products was purified by MicroSpin Columns (GE Healthcare, Tokyo, Japan) and analyzed by standard Sanger sequencing. Sequence homology of these PCR products with HHV-6B strains HST (AB021506.1), Z29 (AF157706.1) and HHV-6A U1102 (X83413.1) were analyzed by Genetyx.![]()
Primer positions on HHV-6B genome DNA. Each primer pair is indicated by arrows. Primer sequences are listed in Table S2
9
Plasma RNA Extraction and Nested PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from 140 µl of plasma using a QIAmp viral RNA kit according to the manufacturer's instructions (Qiagen Inc., USA). A nested polymerase chain reaction (PCR) was performed using AmpliTaq Gold (Roche Molecular Systems, Branchburg, NJ) [24 (link)]. PCR products of correct size were confirmed by agarose gel electrophoresis, purified, and sequenced by dideoxynucleoside-based analysis using a BigDye terminator kit (Applied Biosystems) and ABI Prism 3100 equipment (Applied Biosystems, Foster City, US) [25 (link)].
10
Zebrafish Developmental Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers designed to amplify zebrafish ndst1a, ndst1b, ndst2a, ndst2b and ndst3 genes were used to perform RT-PCR on cDNA prepared from different zebrafish developmental stages ranging from 2-cell stage up till 50 hpf (primer sequences are available upon request). The PCR reaction (35 cycles) was carried out using AmpliTaq Gold (Roche).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!