For Oil Red O staining, the manufacturer’s guidelines (Abcam, ab150678) were followed and slides mounted in aqueous media (Sigma-Aldrich, GG1).
AAV virus production and i.p. injection into mice. The AAV-DJ/8 Helper Free Expression System (Cell Biolabs, VPK-410-DJ-8) was used to generate the virus. The N-terminal FLAG-tagged Human DYRK1B ORF (Sino Biologicals, HG12248-NF) and DYRK1BK140R,Y273F were cloned into the AAV expression vector. The plasmids encoding adenoviral gene products and Rep-Cap proteins and AAV expression vectors encoding DYRK1B-WT or DYRK1BK140R,Y273F or with no insert (AAV control) were cotransfected into 293AAV cells (Cell Biolabs, AAV-100). The virus was released from the cell lysates according to the manufacturer’s instructions (AAV-DJ/8 Helper Free Expression System), and nucleic acids were digested by benzonase (50 U/mL) at 37°C for 30 minutes and purified by iodixanol density-gradient ultracentrifugation. The titers of AAV were obtained by quantitative PCR (qPCR; Clontech, 632252) using the following primers: forward, AGTTGGCCACTCCCTCTCTGC; reverse, TGCAGGCAGCTGCGCGCT. One hundred vector genomes were injected i.p. per mouse twice at a duration of 1 month, and mice were sacrificed 3 months later. AAV8-GFP (GFP in the expression vector) was injected to check for in vivo transduction efficiency.
AAV virus production and i.p. injection into mice. The AAV-DJ/8 Helper Free Expression System (Cell Biolabs, VPK-410-DJ-8) was used to generate the virus. The N-terminal FLAG-tagged Human DYRK1B ORF (Sino Biologicals, HG12248-NF) and DYRK1BK140R,Y273F were cloned into the AAV expression vector. The plasmids encoding adenoviral gene products and Rep-Cap proteins and AAV expression vectors encoding DYRK1B-WT or DYRK1BK140R,Y273F or with no insert (AAV control) were cotransfected into 293AAV cells (Cell Biolabs, AAV-100). The virus was released from the cell lysates according to the manufacturer’s instructions (AAV-DJ/8 Helper Free Expression System), and nucleic acids were digested by benzonase (50 U/mL) at 37°C for 30 minutes and purified by iodixanol density-gradient ultracentrifugation. The titers of AAV were obtained by quantitative PCR (qPCR; Clontech, 632252) using the following primers: forward, AGTTGGCCACTCCCTCTCTGC; reverse, TGCAGGCAGCTGCGCGCT. One hundred vector genomes were injected i.p. per mouse twice at a duration of 1 month, and mice were sacrificed 3 months later. AAV8-GFP (GFP in the expression vector) was injected to check for in vivo transduction efficiency.