The primers for the amplification of FGD1 (GenBank accession no. NM_004463.2) were designed using UCSC ExonPrimer online software (http://genome.ucsc.edu/index.html ). The primers designed for exon 6 of FGD1 gene were as follows: Forward, 5-AACCCTAACCCCATTCCCTG-3 and reverse, 5-GCCCGGCTCTGATTCCTTTT-3. Both exons and exon-intron boundaries were amplified using polymerase chain reaction (PCR). The reaction mixture for each amplification contained 1X Premix Taq (Ex Taq version 2.0; RR003; Takara Biotechnology Co., Ltd., Dalian, China), and reaction was carried out with the following PCR conditions: Initial denaturation at 95°C for 5 min, then 19 cycles of 95°C for 30 sec, 65°C for 30 sec and 72°C for 45 sec, followed by 14 cycles of 95°C for 30 sec, 55°C for 30 sec and 72°C for 45 sec, and a final elongation step at 72°C for 5 min using a C1000™ Thermal Cycler PCR instrument (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The products were examined on a 1% agarose gel and purified with a QIAquick Gel Extraction kit (Qiagen GmbH). The resulting DNA was sequenced using the ABI3730XL sequencer (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) with the forward and reverse primers. The sequence data was then analyzed using Mutation Surveyor® DNA Variant Analysis Software (version 4.0.4; SoftGenetics, LLC.).
Mutation surveyor dna variant analysis software
Manufactured by SoftGenetics
Sourced in United States
Mutation Surveyor DNA Variant Analysis Software is a tool designed for the analysis and detection of genetic variants and mutations in DNA sequences. It provides a comprehensive set of features for visualizing, annotating, and interpreting DNA sequence data.
Automatically generated - may contain errors
Lab products found in correlation
Abi 3730xl sequencer, by Thermo Fisher Scientific (3 mentions)
Qiaquick gel extraction kit, by Qiagen (3 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (3 mentions)
Kapa2g robust pcr kit, by Roche (2 mentions)
C1000 thermal cycler pcr instrument, by Bio-Rad (1 mentions)
Platinum taq green hot start dna polymerase, by Thermo Fisher Scientific (1 mentions)
Geneamp pcr system 9700 thermal cycler, by Thermo Fisher Scientific (1 mentions)
Purelink pcr purification kit, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna mini kit, by Qiagen (1 mentions)
Sephadex g 50, by Merck Group (1 mentions)
Abi prism 3130xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator kit, by PerkinElmer (1 mentions)
Geneamp pcr system 2700 thermal cycler, by Thermo Fisher Scientific (1 mentions)
Hotstartaq master mix kit, by Qiagen (1 mentions)
Exosap it reagent, by Thermo Fisher Scientific (1 mentions)
Bigdye direct cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Exosap it kit, by GE Healthcare (1 mentions)
Abi prism 3730xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Abi 3730xl, by Thermo Fisher Scientific (1 mentions)
Taq dna polymerase, by Takara Bio (1 mentions)
16 protocols using mutation surveyor dna variant analysis software
1
FGD1 Gene Amplification and Sequencing
2
NSUN2 Gene Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We designed primers to amplify the NSUN2 gene (GenBank accession no. NM_017755.5) using Primer 3 software (http://primer3.ut.ee/ ). The primers designed for exon 9 were: forward, 5’‐CAGAGAAAACCCCAGCTCAC‐3’ and reverse, 5’‐CAACCCACAGTGCAGACG‐3’. Exons and exon‐intron boundaries were amplified by polymerase chain reaction (PCR; Takara Bio Inc.). The PCR products were sequenced using an ABI3730XL sequencer (Applied Biosystems) with both forward and backward primers, then the data were analyzed using Mutation Surveyor DNA Variant Analysis Software (SoftGenetics LLC.).
3
TP53 Variant Detection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TP53 variant was analyzed by PCR and Sanger sequencing for 6 tumor tissues, 3 corresponding peripheral blood mononuclear cells (PBMC). DNA was extracted according to standard protocols. Primers for exon 2 to 11 of TP53 gene were synthetized (Table 2 ). PCR amplification was performed in a volume of 20 μl according KAPA2G Robust PCR kit (KAPA Biosystems) protocol. Sequence analysis (ABI 3730XL sequencer) and pathogenic variant identification were performed with Mutation Surveyor DNA variant analysis software (Softgenetics, USA). Variants were checked against the International Agency for Research on Cancer (IARC) p53 database (http://p53.iarc.fr ).
4
Sanger Sequencing of SF3B1 Exons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted using a QIAamp DNA Mini Kit (QIAGEN, 51306) according to the manufacturer’s protocol. PCR reactions were run using Platinum™ Taq Green Hot Start DNA Polymerase (Invitrogen) in a GeneAmp PCR System 9700 thermal cycler (Applied Biosystems, Waltham, MA, USA) using the following primers:
SF3B1 Ex14 F: ACCAACTCATGACTGTCCTTTC, R: ACAACTTACCATGTTCAATG
SF3B1 Ex15-16 F: AACTTAGGTAATGTTGGGGCA, R: TCAACTGACCTGAAATGAAGAGA
SF3B1 Ex18 F: CCTTGGAAAAGCAGTCTAAAAGG, R: GTCAACCTTTTCTAACCACCCA
5
Validation of Somatic Mutations and Structural Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR primers (IDT) were designed to flank the variant positions using Primer3 (Koressaar and Remm 2007 (link); Untergrasser et al. 2012 (link)). All primers are included in Supplemental Table S2. Amplification products for each sample were generated by 35 cycles of PCR using 20-ng template DNA. The products were purified and thermal cycled for 35 cycles of 96°C (20 sec), 50°C (5 sec), and 60°C (3 min) with an appropriately diluted BigDye Terminator v.3.1 Cycle Sequencing Kit (Life Technologies). Following incubation at 12°C, the products were purified over hydrated Sephadex G-50 (Sigma-Aldrich) in 45 micron Multiscreen HV filter plates (Merck Millipore). The eluted fluorescently tagged products were then detected on an ABI Prism 3130xl Genetic Analyzer (Life Technologies) using POP-7 Polymer on a 50-cm Array according to manufacturer's specifications. The data were then analyzed for variants using Mutation Surveyor DNA Variant Analysis Software (Softgenetics). In the current study, 9 out of 11 high confidence SNVs and 8 out of 19 low confidence SNVs were validated as somatic mutations. For validation of SVs, two sets of primers were designed spanning junction. Amplification of the novel amplicon with these primers sets was visualized on an ethidium bromide agarose gel and then sequenced to confirm breakpoints. We validated 12 out of the 13 putative SVs.
6
Targeted Sequencing of H-RAS and K-RAS in FFPE Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from 10-µm cuts of FFPE tissues followed by microdissection. The DNA extraction kit (Citogene®, Citomed, Portugal) was used in accordance with manufacturer’s protocol. PCRs were performed with PromegaGoTaq® G2 Flexi DNA polymerase (Promega, Southampton, UK) and with the recommended settings. Sanger sequencing was achieved using the BigDye Terminator Kit (Perkin-Elmer, CA, USA) and with the fragments running in an ABI (Applied Biosystems) prism 3100 Genetic Analyzer (Perkin-Elmer, CA, USA). Independent PCR amplification and sequencing were performed for both positive and inconclusive (not confirmed as positive or negative) samples. Sequencing analysis targeted exons 1 and 2 of H-RAS and K-RAS. The sequencing reactions were performed in a sense direction for exon 1 and in anti-sense direction for exon 2. Mutations were evaluated and classified using the Mutation Surveyor DNA variant analysis software (Softgenetics, PA, USA) and were matched to reference control sequences from GenBank.
7
Genotyping of CYP4F2 Polymorphisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequences containing the CYP4F2 W12G and V433M polymorphisms were amplified by PCR. The primer sequences for PCR amplification were 5′-CAGGAAGTCCATCCATCCTGA-3′ for W12G-F;5′-GGCCTTTCTGGACTTTACCTCT-3′ for W12G-R; 5′-CTCTAGGAGCCTTGGAATGGA-3′ for V433M-F and 5′- CTCCTGACTGCTCCCTTCTCTC-3′for V433M-R. PCR reactions were set up in a 25 ul volume using the HotStar Taq Master Mix Kit (Qiagen, CA, USA) with 10 pmol of each primer and 10 ng DNA. DNA amplification was performed in the GeneAmp PCR System 2700 thermal cycler (Applied Biosystems, CA, USA) with the following program: 10 min at 95°C for 1 cycle, followed by 35 cycles of 95°C for 10 s, 58°C for 20 s and 72°C for 40 s and 1 final extension cycle of 72°C for 7 min. PCR products were then purified using the ExoSAP-IT reagent (Affymetrix, CA, USA) according to the manufacturer's instructions. The purified PCR products were directly sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA) according to the manufacturer's instructions, and the sequencing results and genotypes were read and summarized using the Mutation Surveyor DNA Variant Analysis Software (Softgenetics, PA, USA).
8
Sanger Sequencing for SNV Validation
9
HER2 Gene Sequencing Protocol
10
Amplification and Sequencing of PTEN Exons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR amplification was performed for all 9 exons of PTEN using primers (Table I ) and genomic DNA from dissected FFPE tissue. PCR amplification was performed in 20 µl reaction volumes that contained 75 mM Tris-HCl, 1.5 mM MgCl2, 50 mM KCl, 20 mM (NH4)2SO4, 0.2 mM of each primer, and 1 U Taq DNA polymerase (Takara Bio, Inc., Otsu, Japan). The PCR experiments were conducted under the following conditions: An initial 5 min denaturation at 95°C; 35 cycles of 1 min each at 94, 57, and 72°C; and a single final extension step for 10 min at 72°C. Amplified PCR products were sequenced at Beckman Coulter, Inc. (Brea, CA, USA) and analyzed using the Mutation Surveyor DNA Variant Analysis Software (version 4.0.6; SoftGenetics LLC, State College, PA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!