The largest database of trusted experimental protocols

Ab7900 machine

Manufactured by Thermo Fisher Scientific
Sourced in Australia

The AB7900 machine is a real-time PCR (Polymerase Chain Reaction) system designed for accurate and sensitive nucleic acid analysis. It features a compact and efficient design with a high-performance thermal cycler and advanced optics to enable reliable and reproducible results.

Automatically generated - may contain errors

3 protocols using ab7900 machine

1

Kidney Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from kidney tissue using Trizol. cDNA was synthesised using Superscript III (Life Technologies) first strand synthesis. The cDNA was subjected to standard curve measurement to ensure efficiency prior to real time PCR, which was done using SYBR green (Life Technologies, Australia) for MCP-1, fibronectin, TGFβ, collagen IV, GLUT1 and GLUT2 using actin as the endogenous control. PCR for SGLT2 and SGLT1 were done using Taqman PCR Universal Mastermix (Applied Biosystems). The RTPCR was performed on the AB7900 machine (Applied Biosystems, Australia). Gene expression was quantified relative to actin. The primers are listed in Table 2.
+ Open protocol
+ Expand
2

Quantitative Analysis of Kidney Fibrosis Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from whole kidney tissue using the RNeasy Plus Mini extraction kit (Qiagen Valencia, CA, USA). cDNA was synthesised using the Transcriptor First Strand cDNA synthesis kit (Roche Diagnostics, Mannheim, Germany). Predesigned primers (Sigma-Aldrich, NSW Australia) for fibronectin, collagen I and IV, αSMA, E-Cadherin and actin are listed in Table 2. Quantitative real-time PCR was performed with SensiMix SYBR hiRox (Bioline, NSW Australia) on the AB7900 machine (Applied Biosystems, Australia). Gene expression is presented as fold-change compared with control after normalisation to the housekeeping gene actin.

PCR primer sequences.

TargetForward (5′-3′)Reverse (5′-3′)
LOXL2ATTAACCCCAACTATGAAGTGCTGTCTCCTCACTGAAGGCTC
FibronectinACAGAAATGACCATTGAAGGTGTCTGGAGAAAGGTTGATT
COL1A1CATGTTCAGCTTTGTGGACCTGCAGCTGACTTCAGGGATGT
Col IVTTAAAGGACTCCAGGGACCACCCCACTGAGCCCTGTCACAC
aSMAATAGGTGGTTTCGTGGATGCACTCTCTTCCAGCCATCTTTCA
E-CadherinCAAAGTGACGCTGAAGTCCATACACGCTGGGAAACATGAG
β-ActinCTAAGGCCAACCGTGAAAAGACCAGAGGCATACAGGGACA
+ Open protocol
+ Expand
3

Kidney Tissue RNA Extraction and RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from kidney tissue using Qiagen RNEasy Mini kit on an automated RNA extraction protocol using Qiacube. cDNA was synthesised using Roche Transcriptor First Strand cDNA synthesis kit (Roche, USA). The real time PCR was done using SYBR green (Bioline, Australia) for fibronectin (forward-CACGGAGGCCACCATTACT and reverse-CTTCAGGGCAATGACGTAGAT) using actin (forward-CAGCTGAGAGGGAAATCGTG and reverse-CGTTGCCAATAGTGATGACC) as the endogenous control. Primers were sourced from Sigma. The RT-PCR was performed on the AB7900 machine (Applied Biosystems, Australia).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!